Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR36673
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Tang, Z.; Li, S.; Bian, Y.; Chen, Z.; Wang, Y.; Zhang, Y.; Li, Y.; Liu, Y.; Yang, M.; Kong, L.; Wang, K.. "NMR Solution Structure of the Major TMPRSS2 Promoter G-Quadruplex and Its Complex with Berberine
" .
Assembly members:
DNA (5'-D(*TP*CP*TP*GP*GP*GP*CP*GP*GP*GP*CP*GP*AP*GP*GP*GP*CP*GP*GP*GP*AP*GP*C)-3'), polymer, 23 residues, 7244.633 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis Host organism: unidentified
Entity Sequences (FASTA):
DNA (5'-D(*TP*CP*TP*GP*GP*GP*CP*GP*GP*GP*CP*GP*AP*GP*GP*GP*CP*GP*GP*GP*AP*GP*C)-3'): TCTGGGCGGGCGAGGGCGGG
AGC
| Data type | Count |
| 1H chemical shifts | 209 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entity 1, entity_1 23 residues - 7244.633 Da.
| 1 | DT | DC | DT | DG | DG | DG | DC | DG | DG | DG | ||||
| 2 | DC | DG | DA | DG | DG | DG | DC | DG | DG | DG | ||||
| 3 | DA | DG | DC |
sample_1: TMPRSS2_Pu23m3 1.93 mM; H2O 90%; D2O, [U-2H], 10%
sample_conditions_1: ionic strength: 10 mM; pH: 7.0; pressure: 1 atm; temperature: 278 K
sample_conditions_2: ionic strength: 10 mM; pH: 7.0; pressure: 1 atm; temperature: 288 K
sample_conditions_3: ionic strength: 10 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_2 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_3 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_3 |
| 2D DQF-COSY | sample_1 | isotropic | sample_conditions_3 |
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - structure calculation
TopSpin, Bruker Biospin - collection
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - structure calculation
NMRFAM-SPARKY, Woonghee Lee - peak picking