Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR36640
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: He, Axin; Wan, Liqi; Zhang, Yuchao; Yan, Zhenzhen; Guo, Pei; Han, Da; Tan, Weihong. "Structure-based investigation of a DNA aptamer targeting PTK7 reveals an intricate 3D fold guiding functional optimization.
" Proc. Natl. Acad. Sci. U. S. A. 121, e2404060121-e2404060121 (2024).
PubMed: 38985770
Assembly members:
DNA, polymer, 41 residues, 12651.133 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis Host organism: unidentified
Entity Sequences (FASTA):
DNA: ATCTAACTGCTGCGCCGCCG
GGAAAATACTGTACGGTTAG
A
| Data type | Count |
| 1H chemical shifts | 106 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entity 1, entity_1 41 residues - 12651.133 Da.
| 1 | DA | DT | DC | DT | DA | DA | DC | DT | DG | DC | ||||
| 2 | DT | DG | DC | DG | DC | DC | DG | DC | DC | DG | ||||
| 3 | DG | DG | DA | DA | DA | DA | DT | DA | DC | DT | ||||
| 4 | DG | DT | DA | DC | DG | DG | DT | DT | DA | DG | ||||
| 5 | DA |
sample_1: DNA 0.5 mM; Magnesium chloride 5 mM; sodium phosphate 10 mM; DSS 0.02 mM; D2O, [U-2H], 99.96%
sample_conditions_1: ionic strength: 15 mM; pH: 7; pressure: 1 bar; temperature: 277 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H COSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
TopSpin, Bruker Biospin - chemical shift assignment
GROMACS, Abraham, Alekseenko, Bauer, Bergh, Blau, Briand, Doijade,... and Zhmurov - structure calculation
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement