Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR36569
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Takase, N.; Kawai, G.. "Another hairpin structure found in the RNA element involved in piRNA biogenesis
" .
Assembly members:
RNA (27-MER), polymer, 27 residues, 8642.199 Da.
Natural source: Common Name: not available Taxonomy ID: 7227 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis Host organism: unidentified
Entity Sequences (FASTA):
RNA (27-MER): ACUCGAAAGAACAUGUUUUC
CAAGAGU
| Data type | Count |
| 1H chemical shifts | 107 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entity 1, entity_1 27 residues - 8642.199 Da.
| 1 | A | C | U | C | G | A | A | A | G | A | ||||
| 2 | A | C | A | U | G | U | U | U | U | C | ||||
| 3 | C | A | A | G | A | G | U |
sample_1: RNA (27-MER) 0.13 mM; NaCl 50 mM; Na2HPO4/NaH2PO4 20 mM; H2O 95%; D2O, [U-2H], 5%
sample_conditions_1: ionic strength: 50 mM; pH: 6.5; pressure: 1 atm; temperature: 288 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H HOHAHA | sample_1 | isotropic | sample_conditions_1 |
Sparky v3.114, Goddard - chemical shift assignment
CNS v1.3, Brunger, Adams, Clore, Gros, Nilges and Read - structure calculation
Sparky v3.114, Goddard - peak picking