Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR36268
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Liu, Liu-Yi; Liu, Wenting; Wang, Kang-Nan; Zhu, Bo-Chen; Xia, Xiao-Yu; Ji, Liang-Nian; Mao, Zong-Wan. "Quantitative Detection of G-Quadruplex DNA in Live Cells Based on Photon Counts and Complex Structure Discrimination." Angew. Chem Int Ed Engl. 59, 9719-9726 (2020).
PubMed: 32173994
Assembly members:
G-quadruplex DNA wtTel26, polymer, 26 residues, 8200.269 Da.
4,4',4''-(nitrilotris(benzene-4,1-diyl))tris(1-ethylpyridin-1-ium) iodide, non-polymer, 563.754 Da.
Natural source: Common Name: human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis Host organism: unidentified
Entity Sequences (FASTA):
G-quadruplex DNA wtTel26: TTAGGGTTAGGGTTAGGGTT
AGGGTT
| Data type | Count |
| 1H chemical shifts | 254 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
| 2 | entity_D6F | 2 |
Entity 1, entity_1 26 residues - 8200.269 Da.
| 1 | DT | DT | DA | DG | DG | DG | DT | DT | DA | DG | ||||
| 2 | DG | DG | DT | DT | DA | DG | DG | DG | DT | DT | ||||
| 3 | DA | DG | DG | DG | DT | DT |
Entity 2, entity_D6F - C39 H39 N4 - 563.754 Da.
| 1 | D6F |
sample_1: G-quadruplex DNA wtTel26 1 mM; H2O 90%; D2O, [U-2H], 10%
sample_conditions_1: ionic strength: 100 mM; pH: 7; pressure: 1 atm; temperature: 298 K
sample_conditions_2: ionic strength: 100 mM; pH: 7; pressure: 1 atm; temperature: 278 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D NOESY | sample_1 | anisotropic | sample_conditions_1 |
| 2D TOCSY | sample_1 | anisotropic | sample_conditions_1 |
| 2D COSY | sample_1 | anisotropic | sample_conditions_1 |
| 2D NOESY | sample_1 | anisotropic | sample_conditions_2 |
| 2D TOCSY | sample_1 | anisotropic | sample_conditions_2 |
| 2D COSY | sample_1 | anisotropic | sample_conditions_2 |
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - structure calculation
Sparky, Goddard - chemical shift assignment
Sparky, Goddard - peak picking