Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR31206
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Wang, Y.; Bian, Y.; Chen, X.; Li, J.; Liu, Y.; Kong, L.; Wang, K.. "BLM G-quadruplex stabilizers synergize with PARP inhibitor to kill BRCA wild-type colon cancer cells" .
Assembly members:
entity_1, polymer, 21 residues, 6698.320 Da.
entity_KPT, non-polymer, 320.319 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TGAGGGAGGGCGGGAGGGAA
T
| Data type | Count |
| 1H chemical shifts | 220 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
| 2 | unit_2 | 2 |
| 3 | unit_3 | 2 |
Entity 1, unit_1 21 residues - 6698.320 Da.
| 1 | DT | DG | DA | DG | DG | DG | DA | DG | DG | DG | ||||
| 2 | DC | DG | DG | DG | DA | DG | DG | DG | DA | DA | ||||
| 3 | DT |
Entity 2, unit_2 - C19 H14 N O4 - 320.319 Da.
| 1 | KPT |
sample_1: BLM_Pu21T_COP 1.62 mM
sample_conditions_1: ionic strength: 50 mM; pH: 7; pressure: 1 atm; temperature: 288 K
sample_conditions_2: ionic strength: 50 mM; pH: 7; pressure: 1 atm; temperature: 298 K
sample_conditions_3: ionic strength: 50 mM; pH: 7; pressure: 1 atm; temperature: 308 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_2 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_3 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_2 |
| 2D DQF-COSY | sample_1 | isotropic | sample_conditions_2 |
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, and Kollman - structure calculation
TopSpin, Bruker Biospin - collection
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - structure calculation
NMRFAM-SPARKY, Woonghee Lee - peak picking