BMRB Entry 31165
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR31165
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Zhu, Ying; Chaubey, Bhawna; Olsen, Gregory; Varani, Gabriele. "Structure of Essential RNA Regulatory Elements in the West Nile Virus 3'-Terminal Stem Loop" J. Mol. Biol. 436, 168767-168767 (2024).
PubMed: 39214284
Assembly members:
entity_1, polymer, 50 residues, 16050.560 Da.
Natural source: Common Name: West Nile virus Taxonomy ID: 11082 Superkingdom: Viruses Kingdom: not available Genus/species: Orthoflavivirus nilense
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGAUCUUCUGCUCUGCACAA
CCUUCGGGUGGUGCGAGAXC
ACAGGAUACC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 159 |
| 15N chemical shifts | 33 |
| 1H chemical shifts | 321 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
Entities:
Entity 1, unit_1 50 residues - 16050.560 Da.
| 1 | G | G | A | U | C | U | U | C | U | G | |
| 2 | C | U | C | U | G | C | A | C | A | A | |
| 3 | C | C | U | U | C | G | G | G | U | G | |
| 4 | G | U | G | C | G | A | G | A | AP7 | C | |
| 5 | A | C | A | G | G | A | U | A | C | C |
Samples:
sample_1: RNA (50-MER) 1 ± 0.1 mM; potassium phosphate 20 ± 0.2 mM
sample_2: RNA (50-MER) 1 ± 0.1 mM
sample_3: RNA (50-MER), [U-99% 13C; U-99% 15N], 0.8 ± 0.1 mM
sample_4: RNA (50-MER), [U-99% 13C; U-99% 15N], 0.8 ± 0.1 mM
sample_5: RNA (50-MER), [U-2H], 0.8 ± 0.1 mM
sample_conditions_1: ionic strength: 20 mM; pH: 6.4; pressure: 1 atm; temperature: 310 K
sample_conditions_2: ionic strength: 20 mM; pH: 6.4; pressure: 1 atm; temperature: 288 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_2 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_3 | isotropic | sample_conditions_2 |
| 2D 1H-13C HSQC | sample_4 | isotropic | sample_conditions_1 |
| 3D 1H-13C NOESY | sample_4 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_5 | isotropic | sample_conditions_1 |
Software:
TopSpin, Bruker Biospin - processing
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation
NMRFAM-SPARKY, Woonghee Lee, John L. Markley - chemical shift assignment
NMR spectrometers:
- Bruker AVANCE II 600 MHz
- Bruker AVANCE II 800 MHz