BMRB Entry 28090
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR28090
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: O'Loughlin, Sinead; Capece, Mark; Klimova, Mariia; Wills, Norma; Coakley, Arthur; Samatova, Ekaterina; O'Connor, Patrick; Loughran, Gary; Weissman, Jonathan; Baranov, Pavel; Rodnina, Marina; Puglisi, Joseph; Atkins, John. "Polysomes bypass a 50 nucleotide coding gap less efficiently than monosomes due to attenuation of an unstable 5' mRNA stem loop stimulator and enhanced drop-off" J. Mol. Biol. 432, 4369-4387 (2020).
PubMed: 32454154
Assembly members:
5'_stem_loop, polymer, 30 residues, Formula weight is not available
Natural source: Common Name: T4 bacteriophage Taxonomy ID: 38018 Superkingdom: Viruses Kingdom: not available Genus/species: T4 bacteriophage
Experimental source: Production method: in vitro transcription Host organism: T7 RNA polymerase Vector: N/A
Entity Sequences (FASTA):
5'_stem_loop: GUGCGAAUGUCGCUAUUAUG
ACAGACGCAC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 73 |
| 15N chemical shifts | 44 |
| 1H chemical shifts | 135 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | 5' stem loop | 1 |
Entities:
Entity 1, 5' stem loop 30 residues - Formula weight is not available
| 1 | G | U | G | C | G | A | A | U | G | U | |
| 2 | C | G | C | U | A | U | U | A | U | G | |
| 3 | A | C | A | G | A | C | G | C | A | C |