Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR16479
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Ottink, Otmar; Westerweele, Ivo; Tesssari, Marco; Nelissen, Frank; Heus, Hans; Wijmenga, Sybren. "(1)H and (13)C resonance assignments of a guanine sensing riboswitch's terminator hairpin." Biomol. NMR Assignments 4, 89-91 (2010).
PubMed: 20204714
Assembly members:
G-riboswitch_terminator_hairpin, polymer, 35 residues, Formula weight is not available
Natural source: Common Name: Bacillus subtilis Taxonomy ID: 1423 Superkingdom: Bacteria Kingdom: not available Genus/species: Bacillus subtilis
Experimental source: Production method: recombinant technology Host organism: Escherichia coli Vector: pUC18
Entity Sequences (FASTA):
G-riboswitch_terminator_hairpin: GGCAUUGCUUGCUCUUUAUU
UGAGCGGGCAAUGCC
Data type | Count |
13C chemical shifts | 90 |
1H chemical shifts | 119 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | subunit 1 | 1 |
Entity 1, subunit 1 35 residues - Formula weight is not available
1 | G | G | C | A | U | U | G | C | U | U | ||||
2 | G | C | U | C | U | U | U | A | U | U | ||||
3 | U | G | A | G | C | G | G | G | C | A | ||||
4 | A | U | G | C | C |