Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR52689
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Chao, Emily; Largy, Eric; Kaiyum, Yunus; Nguyen, Minh-Dat; Vialet, Brune; Dauphin-Ducharme, Philippe; Johnson, Philip; Mackereth, Cameron. "Dopamine binding by a DNA aptamer devoid of canonical duplex or G-quadruplex" .
Assembly members:
entity_1, polymer, . residues, Formula weight is not available
entity_LDP, non-polymer, 153.178 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TTGAAGGTTCGTTCGCAGGT
GTGGAGT
| Data type | Count |
| 15N chemical shifts | 25 |
| 1H chemical shifts | 216 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | DNA aptamer | 1 |
| 2 | dopamine | 2 |
Entity 1, DNA aptamer - Formula weight is not available
| 1 | DT | DT | DG | DA | DA | DG | DG | DT | DT | DC | ||||
| 2 | DG | DT | DT | DC | DG | DC | DA | DG | DG | DT | ||||
| 3 | DG | DT | DG | DG | DA | DG | DT |
Entity 2, dopamine - C8 H11 N O2 - 153.178 Da.
| 1 | LDP |
sample_1: RKEC1 2 mM; dopamine 2.25 mM; sodium phosphate 20 mM; sodium chloride 140 mM; magnesium chloride 2 mM
sample_2: RKEC1 2 mM; dopamine 2.25 mM; sodium phosphate 20 mM; sodium chloride 140 mM; magnesium chloride 2 mM
sample_conditions_1: ionic strength: 170 mM; pH: 7.4; pressure: 1 atm; temperature: 278 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 1D 1H | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
TOPSPIN v4.1 - collection
NMRPipe - processing
NMRFAM-SPARKY v1.470 - chemical shift assignment, data analysis, peak picking