BMRB Entry 50974

Title:
Average nucleotide chemical shifts of the free full-length RNA from MS2 bacteriophage
Deposition date:
2021-06-15
Original release date:
2021-10-10
Authors:
Lusky, Orr; Meir, Moran; Goldbourt, Amir
Citation:

Citation: Lusky, Orr; Meir, Moran; Goldbourt, Amir. "Characterizing Hydrogen Bonds in Intact RNA from MS2 Bacteriophage Using Magic Angle Spinning NMR"  Biophys. Rep. ., .-..

Assembly members:

Assembly members:
entity_1, polymer, 3569 residues, Formula weight is not available

Natural source:

Natural source:   Common Name: E. coli   Taxonomy ID: 562   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Escherichia coli

Experimental source:   Production method: purified from the natural source

Experimental source:

Natural source:   Common Name: E. coli   Taxonomy ID: 562   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Escherichia coli

Experimental source:   Production method: purified from the natural source

Entity Sequences (FASTA):

Entity Sequences (FASTA):
entity_1: GGGUGGGACCCCUUUCGGGG UCCUGCUCAACUUCCUGUCG AGCUAAUGCCAUUUUUAAUG UCUUUAGCGAGACGCUACCA UGGCUAUCGCUGUAGGUAGC CGGAAUUCCAUUCCUAGGAG GUUUGACCUGUGCGAGCUUU UAGUACCCUUGAUAGGGAGA ACGAGACCUUCGUCCCCUCC GUUCGCGUUUACGCGGACGG UGAGACUGAAGAUAACUCAU UCUCUUUAAAAUAUCGUUCG AACUGGACUCCCGGUCGUUU UAACUCGACUGGGGCCAAAA CGAAACAGUGGCACUACCCC UCUCCGUAUUCACGGGGGGC GUUAAGUGUCACAUCGAUAG AUCAAGGUGCCUACAAGCGA AGUGGGUCAUCGUGGGGUCG CCCGUACGAGGAGAAAGCCG GUUUCGGCUUCUCCCUCGAC GCACGCUCCUGCUACAGCCU CUUCCCUGUAAGCCAAAACU UGACUUACAUCGAAGUGCCG CAGAACGUUGCGAACCGGGC GUCGACCGAAGUCCUGCAAA AGGUCACCCAGGGUAAUUUU AACCUUGGUGUUGCUUUAGC AGAGGCCAGGUCGACAGCCU CACAACUCGCGACGCAAACC AUUGCGCUCGUGAAGGCGUA CACUGCCGCUCGUCGCGGUA AUUGGCGCCAGGCGCUCCGC UACCUUGCCCUAAACGAAGA UCGAAAGUUUCGAUCAAAAC ACGUGGCCGGCAGGUGGUUG GAGUUGCAGUUCGGUUGGUU ACCACUAAUGAGUGAUAUCC AGGGUGCAUAUGAGAUGCUU ACGAAGGUUCACCUUCAAGA GUUUCUUCCUAUGAGAGCCG UACGUCAGGUCGGUACUAAC AUCAAGUUAGAUGGCCGUCU GUCGUAUCCAGCUGCAAACU UCCAGACAACGUGCAACAUA UCGCGACGUAUCGUGAUAUG GUUUUACAUAAACGAUGCAC GUUUGGCAUGGUUGUCGUCU CUAGGUAUCUUGAACCCACU AGGUAUAGUGUGGGAAAAGG UGCCUUUCUCAUUCGUUGUC GACUGGCUCCUACCUGUAGG UAACAUGCUCGAGGGCCUUA CGGCCCCCGUGGGAUGCUCC UACAUGUCAGGAACAGUUAC UGACGUAAUAACGGGUGAGU CCAUCAUAAGCGUUGACGCU CCCUACGGGUGGACUGUGGA GAGACAGGGCACUGCUAAGG CCCAAAUCUCAGCCAUGCAU CGAGGGGUACAAUCCGUAUG GCCAACAACUGGCGCGUACG UAAAGUCUCCUUUCUCGAUG GUCCAUACCUUAGAUGCGUU AGCAUUAAUCAGGCAACGGC UCUCUAGAUAGAGCCCUCAA CCGGAGUUUGAAGCAUGGCU UCUAACUUUACUCAGUUCGU UCUCGUCGACAAUGGCGGAA CUGGCGACGUGACUGUCGCC CCAAGCAACUUCGCUAACGG GGUCGCUGAAUGGAUCAGCU CUAACUCGCGUUCACAGGCU UACAAAGUAACCUGUAGCGU UCGUCAGAGCUCUGCGCAGA AUCGCAAAUACACCAUCAAA GUCGAGGUGCCUAAAGUGGC AACCCAGACUGUUGGUGGUG UAGAGCUUCCUGUAGCCGCA UGGCGUUCGUACUUAAAUAU GGAACUAACCAUUCCAAUUU UCGCUACGAAUUCCGACUGC GAGCUUAUUGUUAAGGCAAU GCAAGGUCUCCUAAAAGAUG GAAACCCGAUUCCCUCAGCA AUCGCAGCAAACUCCGGCAU CUACUAAUAGACGCCGGCCA UUCAAACAUGAGGAUUACCC AUGUCGAAGACAACAAAGAA GUUCAACUCUUUAUGUAUUG AUCUUCCUCGCGAUCUUUCU CUCGAAAUUUACCAAUCAAU UGCUUCUGUCGCUACUGGAA GCGGUGAUCCGCACAGUGAC GACUUUACAGCAAUUGCUUA CUUAAGGGACGAAUUGCUCA CAAAGCAUCCGACCUUAGGU UCUGGUAAUGACGAGGCGAC CCGUCGUACCUUAGCUAUCG CUAAGCUACGGGAGGCGAAU GGUGAUCGCGGUCAGAUAAA UAGAGAAGGUUUCUUACAUG ACAAAUCCUUGUCAUGGGAU CCGGAUGUUUUACAAACCAG CAUCCGUAGCCUUAUUGGCA ACCUCCUCUCUGGCUACCGA UCGUCGUUGUUUGGGCAAUG CACGUUCUCCAACGGUGCUC CUAUGGGGCACAAGUUGCAG GAUGCAGCGCCUUACAAGAA GUUCGCUGAACAAGCAACCG UUACCCCCCGCGCUCUGAGA GCGGCUCUAUUGGUCCGAGA CCAAUGUGCGCCGUGGAUCA GACACGCGGUCCGCUAUAAC GAGUCAUAUGAAUUUAGGCU CGUUGUAGGGAACGGAGUGU UUACAGUUCCGAAGAAUAAU AAAAUAGAUCGGGCUGCCUG UAAGGAGCCUGAUAUGAAUA UGUACCUCCAGAAAGGGGUC GGUGCUUUCAUCAGACGCCG GCUCAAAUCCGUUGGUAUAG ACCUGAAUGAUCAAUCGAUC AACCAGCGUCUGGCUCAGCA GGGCAGCGUAGAUGGUUCGC UUGCGACGAUAGACUUAUCG UCUGCAUCCGAUUCCAUCUC CGAUCGCCUGGUGUGGAGUU UUCUCCCACCAGAGCUAUAU UCAUAUCUCGAUCGUAUCCG CUCACACUACGGAAUCGUAG AUGGCGAGACGAUACGAUGG GAACUAUUUUCCACAAUGGG AAAUGGGUUCACAUUUGAGC UAGAGUCCAUGAUAUUCUGG GCAAUAGUCAAAGCGACCCA AAUCCAUUUUGGUAACGCCG GAACCAUAGGCAUCUACGGG GACGAUAUUAUAUGUCCCAG UGAGAUUGCACCCCGUGUGC UAGAGGCACUUGCCUACUAC GGUUUUAAACCGAAUCUUCG UAAAACGUUCGUGUCCGGGC UCUUUCGCGAGAGCUGCGGC GCGCACUUUUACCGUGGUGU CGAUGUCAAACCGUUUUACA UCAAGAAACCUGUUGACAAU CUCUUCGCCCUGAUGCUGAU AUUAAAUCGGCUACGGGGUU GGGGAGUUGUCGGAGGUAUG UCAGAUCCACGCCUCUAUAA GGUGUGGGUACGGCUCUCCU CCCAGGUGCCUUCGAUGUUC UUCGGUGGGACGGACCUCGC UGCCGACUACUACGUAGUCA GCCCGCCUACGGCAGUCUCG GUAUACACCAAGACUCCGUA CGGGCGGCUGCUCGCGGAUA CCCGUACCUCGGGUUUCCGU CUUGCUCGUAUCGCUCGAGA ACGCAAGUUCUUCAGCGAAA AGCACGACAGUGGUCGCUAC AUAGCGUGGUUCCAUACUGG AGGUGAAAUCACCGACAGCA UGAAGUCCGCCGGCGUGCGC GUUAUACGCACUUCGGAGUG GCUAACGCCGGUUCCCACAU UCCCUCAGGAGUGUGGGCCA GCGAGCUCUCCUCGGUAGCU GACCGAGGGACCCCCGUAAA CGGGGUGGGUGUGCUCGAAA GAGCACGGGUGCGAAAGCGG UCCGGCUCCACCGAAAGGUG GGCGGGCUUCGGCCCAGGGA CCUCCCCCUAAAGAGAGGAC CCGGGAUUCUCCCGAUUUGG UAACUAGCUGCUUGGCUAGU UACCACCCA

Data sets:
Data typeCount
15N chemical shifts14

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA1

Entities:

Entity 1, RNA 3569 residues - Formula weight is not available

1   GGGUGGGACC
2   CCUUUCGGGG
3   UCCUGCUCAA
4   CUUCCUGUCG
5   AGCUAAUGCC
6   AUUUUUAAUG
7   UCUUUAGCGA
8   GACGCUACCA
9   UGGCUAUCGC
10   UGUAGGUAGC
11   CGGAAUUCCA
12   UUCCUAGGAG
13   GUUUGACCUG
14   UGCGAGCUUU
15   UAGUACCCUU
16   GAUAGGGAGA
17   ACGAGACCUU
18   CGUCCCCUCC
19   GUUCGCGUUU
20   ACGCGGACGG
21   UGAGACUGAA
22   GAUAACUCAU
23   UCUCUUUAAA
24   AUAUCGUUCG
25   AACUGGACUC
26   CCGGUCGUUU
27   UAACUCGACU
28   GGGGCCAAAA
29   CGAAACAGUG
30   GCACUACCCC
31   UCUCCGUAUU
32   CACGGGGGGC
33   GUUAAGUGUC
34   ACAUCGAUAG
35   AUCAAGGUGC
36   CUACAAGCGA
37   AGUGGGUCAU
38   CGUGGGGUCG
39   CCCGUACGAG
40   GAGAAAGCCG
41   GUUUCGGCUU
42   CUCCCUCGAC
43   GCACGCUCCU
44   GCUACAGCCU
45   CUUCCCUGUA
46   AGCCAAAACU
47   UGACUUACAU
48   CGAAGUGCCG
49   CAGAACGUUG
50   CGAACCGGGC
51   GUCGACCGAA
52   GUCCUGCAAA
53   AGGUCACCCA
54   GGGUAAUUUU
55   AACCUUGGUG
56   UUGCUUUAGC
57   AGAGGCCAGG
58   UCGACAGCCU
59   CACAACUCGC
60   GACGCAAACC
61   AUUGCGCUCG
62   UGAAGGCGUA
63   CACUGCCGCU
64   CGUCGCGGUA
65   AUUGGCGCCA
66   GGCGCUCCGC
67   UACCUUGCCC
68   UAAACGAAGA
69   UCGAAAGUUU
70   CGAUCAAAAC
71   ACGUGGCCGG
72   CAGGUGGUUG
73   GAGUUGCAGU
74   UCGGUUGGUU
75   ACCACUAAUG
76   AGUGAUAUCC
77   AGGGUGCAUA
78   UGAGAUGCUU
79   ACGAAGGUUC
80   ACCUUCAAGA
81   GUUUCUUCCU
82   AUGAGAGCCG
83   UACGUCAGGU
84   CGGUACUAAC
85   AUCAAGUUAG
86   AUGGCCGUCU
87   GUCGUAUCCA
88   GCUGCAAACU
89   UCCAGACAAC
90   GUGCAACAUA
91   UCGCGACGUA
92   UCGUGAUAUG
93   GUUUUACAUA
94   AACGAUGCAC
95   GUUUGGCAUG
96   GUUGUCGUCU
97   CUAGGUAUCU
98   UGAACCCACU
99   AGGUAUAGUG
100   UGGGAAAAGG
101   UGCCUUUCUC
102   AUUCGUUGUC
103   GACUGGCUCC
104   UACCUGUAGG
105   UAACAUGCUC
106   GAGGGCCUUA
107   CGGCCCCCGU
108   GGGAUGCUCC
109   UACAUGUCAG
110   GAACAGUUAC
111   UGACGUAAUA
112   ACGGGUGAGU
113   CCAUCAUAAG
114   CGUUGACGCU
115   CCCUACGGGU
116   GGACUGUGGA
117   GAGACAGGGC
118   ACUGCUAAGG
119   CCCAAAUCUC
120   AGCCAUGCAU
121   CGAGGGGUAC
122   AAUCCGUAUG
123   GCCAACAACU
124   GGCGCGUACG
125   UAAAGUCUCC
126   UUUCUCGAUG
127   GUCCAUACCU
128   UAGAUGCGUU
129   AGCAUUAAUC
130   AGGCAACGGC
131   UCUCUAGAUA
132   GAGCCCUCAA
133   CCGGAGUUUG
134   AAGCAUGGCU
135   UCUAACUUUA
136   CUCAGUUCGU
137   UCUCGUCGAC
138   AAUGGCGGAA
139   CUGGCGACGU
140   GACUGUCGCC
141   CCAAGCAACU
142   UCGCUAACGG
143   GGUCGCUGAA
144   UGGAUCAGCU
145   CUAACUCGCG
146   UUCACAGGCU
147   UACAAAGUAA
148   CCUGUAGCGU
149   UCGUCAGAGC
150   UCUGCGCAGA
151   AUCGCAAAUA
152   CACCAUCAAA
153   GUCGAGGUGC
154   CUAAAGUGGC
155   AACCCAGACU
156   GUUGGUGGUG
157   UAGAGCUUCC
158   UGUAGCCGCA
159   UGGCGUUCGU
160   ACUUAAAUAU
161   GGAACUAACC
162   AUUCCAAUUU
163   UCGCUACGAA
164   UUCCGACUGC
165   GAGCUUAUUG
166   UUAAGGCAAU
167   GCAAGGUCUC
168   CUAAAAGAUG
169   GAAACCCGAU
170   UCCCUCAGCA
171   AUCGCAGCAA
172   ACUCCGGCAU
173   CUACUAAUAG
174   ACGCCGGCCA
175   UUCAAACAUG
176   AGGAUUACCC
177   AUGUCGAAGA
178   CAACAAAGAA
179   GUUCAACUCU
180   UUAUGUAUUG
181   AUCUUCCUCG
182   CGAUCUUUCU
183   CUCGAAAUUU
184   ACCAAUCAAU
185   UGCUUCUGUC
186   GCUACUGGAA
187   GCGGUGAUCC
188   GCACAGUGAC
189   GACUUUACAG
190   CAAUUGCUUA
191   CUUAAGGGAC
192   GAAUUGCUCA
193   CAAAGCAUCC
194   GACCUUAGGU
195   UCUGGUAAUG
196   ACGAGGCGAC
197   CCGUCGUACC
198   UUAGCUAUCG
199   CUAAGCUACG
200   GGAGGCGAAU
201   GGUGAUCGCG
202   GUCAGAUAAA
203   UAGAGAAGGU
204   UUCUUACAUG
205   ACAAAUCCUU
206   GUCAUGGGAU
207   CCGGAUGUUU
208   UACAAACCAG
209   CAUCCGUAGC
210   CUUAUUGGCA
211   ACCUCCUCUC
212   UGGCUACCGA
213   UCGUCGUUGU
214   UUGGGCAAUG
215   CACGUUCUCC
216   AACGGUGCUC
217   CUAUGGGGCA
218   CAAGUUGCAG
219   GAUGCAGCGC
220   CUUACAAGAA
221   GUUCGCUGAA
222   CAAGCAACCG
223   UUACCCCCCG
224   CGCUCUGAGA
225   GCGGCUCUAU
226   UGGUCCGAGA
227   CCAAUGUGCG
228   CCGUGGAUCA
229   GACACGCGGU
230   CCGCUAUAAC
231   GAGUCAUAUG
232   AAUUUAGGCU
233   CGUUGUAGGG
234   AACGGAGUGU
235   UUACAGUUCC
236   GAAGAAUAAU
237   AAAAUAGAUC
238   GGGCUGCCUG
239   UAAGGAGCCU
240   GAUAUGAAUA
241   UGUACCUCCA
242   GAAAGGGGUC
243   GGUGCUUUCA
244   UCAGACGCCG
245   GCUCAAAUCC
246   GUUGGUAUAG
247   ACCUGAAUGA
248   UCAAUCGAUC
249   AACCAGCGUC
250   UGGCUCAGCA
251   GGGCAGCGUA
252   GAUGGUUCGC
253   UUGCGACGAU
254   AGACUUAUCG
255   UCUGCAUCCG
256   AUUCCAUCUC
257   CGAUCGCCUG
258   GUGUGGAGUU
259   UUCUCCCACC
260   AGAGCUAUAU
261   UCAUAUCUCG
262   AUCGUAUCCG
263   CUCACACUAC
264   GGAAUCGUAG
265   AUGGCGAGAC
266   GAUACGAUGG
267   GAACUAUUUU
268   CCACAAUGGG
269   AAAUGGGUUC
270   ACAUUUGAGC
271   UAGAGUCCAU
272   GAUAUUCUGG
273   GCAAUAGUCA
274   AAGCGACCCA
275   AAUCCAUUUU
276   GGUAACGCCG
277   GAACCAUAGG
278   CAUCUACGGG
279   GACGAUAUUA
280   UAUGUCCCAG
281   UGAGAUUGCA
282   CCCCGUGUGC
283   UAGAGGCACU
284   UGCCUACUAC
285   GGUUUUAAAC
286   CGAAUCUUCG
287   UAAAACGUUC
288   GUGUCCGGGC
289   UCUUUCGCGA
290   GAGCUGCGGC
291   GCGCACUUUU
292   ACCGUGGUGU
293   CGAUGUCAAA
294   CCGUUUUACA
295   UCAAGAAACC
296   UGUUGACAAU
297   CUCUUCGCCC
298   UGAUGCUGAU
299   AUUAAAUCGG
300   CUACGGGGUU
301   GGGGAGUUGU
302   CGGAGGUAUG
303   UCAGAUCCAC
304   GCCUCUAUAA
305   GGUGUGGGUA
306   CGGCUCUCCU
307   CCCAGGUGCC
308   UUCGAUGUUC
309   UUCGGUGGGA
310   CGGACCUCGC
311   UGCCGACUAC
312   UACGUAGUCA
313   GCCCGCCUAC
314   GGCAGUCUCG
315   GUAUACACCA
316   AGACUCCGUA
317   CGGGCGGCUG
318   CUCGCGGAUA
319   CCCGUACCUC
320   GGGUUUCCGU
321   CUUGCUCGUA
322   UCGCUCGAGA
323   ACGCAAGUUC
324   UUCAGCGAAA
325   AGCACGACAG
326   UGGUCGCUAC
327   AUAGCGUGGU
328   UCCAUACUGG
329   AGGUGAAAUC
330   ACCGACAGCA
331   UGAAGUCCGC
332   CGGCGUGCGC
333   GUUAUACGCA
334   CUUCGGAGUG
335   GCUAACGCCG
336   GUUCCCACAU
337   UCCCUCAGGA
338   GUGUGGGCCA
339   GCGAGCUCUC
340   CUCGGUAGCU
341   GACCGAGGGA
342   CCCCCGUAAA
343   CGGGGUGGGU
344   GUGCUCGAAA
345   GAGCACGGGU
346   GCGAAAGCGG
347   UCCGGCUCCA
348   CCGAAAGGUG
349   GGCGGGCUUC
350   GGCCCAGGGA
351   CCUCCCCCUA
352   AAGAGAGGAC
353   CCGGGAUUCU
354   CCCGAUUUGG
355   UAACUAGCUG
356   CUUGGCUAGU
357   UACCACCCA

Samples:

sample_1: RNA isolated from MS2, [U-100% 15N], ~100 mg/mL

sample_conditions_1: pressure: 1 atm; temperature: 255 K

Experiments:

NameSampleSample stateSample conditions
2D 15N-15N PDSDsample_1isotropicsample_conditions_1
2D 15N-15N RFDR-PDSDsample_1isotropicsample_conditions_1

Software:

NMRPipe - processing

SPARKY v3.134 - chemical shift assignment

TOPSPIN v3.5 - collection

NMR spectrometers:

  • Bruker AVANCE III 400 MHz