BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 50805

Title: Histone H3 tail within tetrasome   PubMed: 33856458

Deposition date: 2021-03-07 Original release date: 2021-05-27

Authors: Morrison, Emma

Citation: Morrison, Emma; Baweja, Lokesh; Poirier, Michael; Wereszczynski, Jeff; Musselman, Catherine. "Nucleosome composition regulates the histone H3 tail conformational ensemble and accessibility"  Nucleic Acids Res. 49, 4750-4767 (2021).

Assembly members:
entity_1, polymer, 135 residues, Formula weight is not available
entity_2, polymer, 102 residues, Formula weight is not available
entity_3, polymer, 147 residues, Formula weight is not available
entity_4, polymer, 147 residues, Formula weight is not available

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli   Vector: pET3a

Entity Sequences (FASTA):
entity_1: ARTKQTARKSTGGKAPRKQL ATKAARKSAPATGGVKKPHR YRPGTVALREIRRYQKSTEL LIRKLPFQRLVREIAQDFKT DLRFQSSAVMALQEASEAYL VGLFEDTNLAAIHAKRVTIM PKDIQLARRIRGERA
entity_2: SGRGKGGKGLGKGGAKRHRK VLRDNIQGITKPAIRRLARR GGVKRISGLIYEETRGVLKV FLENVIRDAVTYTEHAKRKT VTAMDVVYALKRQGRTLYGF GG
entity_3: ATCGAGAATCCCGGTGCCGA GGCCGCTCAATTGGTCGTAG ACAGCTCTAGCACCGCTTAA ACGCACGTACGCGCTGTCCC CCGCGTTTTAACCGCCAAGG GGATTACTCCCTAGTCTCCA GGCACGTGTCAGATATATAC ATCCGAT
entity_4: ATCGGATGTATATATCTGAC ACGTGCCTGGAGACTAGGGA GTAATCCCCTTGGCGGTTAA AACGCGGGGGACAGCGCGTA CGTGCGTTTAAGCGGTGCTA GAGCTGTCTACGACCAATTG AGCGGCCTCGGCACCGGGAT TCTCGAT

Data sets:
Data typeCount
13C chemical shifts68
15N chemical shifts33
1H chemical shifts33

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1H3, 11
2H3, 21
3H4, 12
4H4, 22
5DNA_13
6DNA_24

Entities:

Entity 1, H3, 1 135 residues - Formula weight is not available

1   ALAARGTHRLYSGLNTHRALAARGLYSSER
2   THRGLYGLYLYSALAPROARGLYSGLNLEU
3   ALATHRLYSALAALAARGLYSSERALAPRO
4   ALATHRGLYGLYVALLYSLYSPROHISARG
5   TYRARGPROGLYTHRVALALALEUARGGLU
6   ILEARGARGTYRGLNLYSSERTHRGLULEU
7   LEUILEARGLYSLEUPROPHEGLNARGLEU
8   VALARGGLUILEALAGLNASPPHELYSTHR
9   ASPLEUARGPHEGLNSERSERALAVALMET
10   ALALEUGLNGLUALASERGLUALATYRLEU
11   VALGLYLEUPHEGLUASPTHRASNLEUALA
12   ALAILEHISALALYSARGVALTHRILEMET
13   PROLYSASPILEGLNLEUALAARGARGILE
14   ARGGLYGLUARGALA

Entity 2, H4, 1 102 residues - Formula weight is not available

1   SERGLYARGGLYLYSGLYGLYLYSGLYLEU
2   GLYLYSGLYGLYALALYSARGHISARGLYS
3   VALLEUARGASPASNILEGLNGLYILETHR
4   LYSPROALAILEARGARGLEUALAARGARG
5   GLYGLYVALLYSARGILESERGLYLEUILE
6   TYRGLUGLUTHRARGGLYVALLEULYSVAL
7   PHELEUGLUASNVALILEARGASPALAVAL
8   THRTYRTHRGLUHISALALYSARGLYSTHR
9   VALTHRALAMETASPVALVALTYRALALEU
10   LYSARGGLNGLYARGTHRLEUTYRGLYPHE
11   GLYGLY

Entity 3, DNA_1 147 residues - Formula weight is not available

1   DADTDCDGDADGDADADTDC
2   DCDCDGDGDTDGDCDCDGDA
3   DGDGDCDCDGDCDTDCDADA
4   DTDTDGDGDTDCDGDTDADG
5   DADCDADGDCDTDCDTDADG
6   DCDADCDCDGDCDTDTDADA
7   DADCDGDCDADCDGDTDADC
8   DGDCDGDCDTDGDTDCDCDC
9   DCDCDGDCDGDTDTDTDTDA
10   DADCDCDGDCDCDADADGDG
11   DGDGDADTDTDADCDTDCDC
12   DCDTDADGDTDCDTDCDCDA
13   DGDGDCDADCDGDTDGDTDC
14   DADGDADTDADTDADTDADC
15   DADTDCDCDGDADT

Entity 4, DNA_2 147 residues - Formula weight is not available

1   DADTDCDGDGDADTDGDTDA
2   DTDADTDADTDCDTDGDADC
3   DADCDGDTDGDCDCDTDGDG
4   DADGDADCDTDADGDGDGDA
5   DGDTDADADTDCDCDCDCDT
6   DTDGDGDCDGDGDTDTDADA
7   DADADCDGDCDGDGDGDGDG
8   DADCDADGDCDGDCDGDTDA
9   DCDGDTDGDCDGDTDTDTDA
10   DADGDCDGDGDTDGDCDTDA
11   DGDADGDCDTDGDTDCDTDA
12   DCDGDADCDCDADADTDTDG
13   DADGDCDGDGDCDCDTDCDG
14   DGDCDADCDCDGDGDGDADT
15   DTDCDTDCDGDADT

Samples:

sample_1: entity_1, [U-13C; U-15N], 130 uM; entity_2 130 uM; entity_3 130 uM; entity_4 130 uM; MOPS 20 mM; NaOH 7 mM; EDTA 1 mM; DTT 1 mM

sample_conditions_1: pH: 7; temperature: 310 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
3D HNCACBsample_1isotropicsample_conditions_1
3D CBCA(CO)NHsample_1isotropicsample_conditions_1

Software:

TOPSPIN - collection

NMRPipe - processing

ANALYSIS v2.4 - chemical shift assignment

NMR spectrometers:

  • Bruker AVANCE NEO 600 MHz

Download simulated HSQC data in one of the following formats:
CSV: Backbone or all simulated shifts
SPARKY: Backbone or all simulated shifts