BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 50760

Title: 1H, 13C,15N and 31P chemical shift assignment of the stem-loop 4 from the 5'-UTR of SARS-CoV-2   PubMed: 33928512

Deposition date: 2021-02-10 Original release date: 2021-05-18

Authors: Vogele, Jennifer; Ferner, Jan-Peter; Altincekic, Nadide; Kaur Bains, Jasleen; Ceylan, Betul; Furtig, Boris; Grun, J Tassilo; Hengesbach, Martin; Hohmann, Katharina; Hymon, Daniel; Knezic, Bozana; Peter, Stephen; Pyper, Dennis; Qureshi, Nusrat; Richter, Christian; Schlundt, Andreas; Schnieders, Robbin; Schwalbe, Harald; Stirnal, Elke; Sudakov, Alexey; Wacker, Anna; Weigand, Julia; Wirmer-Baroschek, Julia; Wohnert, Jens; Duchardt-Ferner, Elke

Citation: Vogele, Jennifer; Ferner, Jan-Peter; Altincekic, Nadide; Kaur Bains, Jasleen; Ceylan, Betul; Furtig, Boris; Grun, J Tassilo; Hengesbach, Martin; Hohmann, Katharina; Hymon, Daniel; Knezic, Bozana; Peter, Stephen; Pyper, Dennis; Qureshi, Nusrat; Richter, Christian; Schlundt, Andreas; Schnieders, Robbin; Schwalbe, Harald; Stirnal, Elke; Sudakov, Alexey; Wacker, Anna; Weigand, Julia; Wirmer-Baroschek, Julia; Wohnert, Jens; Duchardt-Ferner, Elke. "1H, 13C, 15N and 31P chemical shift assignment for stem-loop 4 from the 5'-UTR of SARS-CoV-2"  Biomolecular NMR Assignments ., .-. (2021).

Assembly members:
entity_1, polymer, 25 residues, Formula weight is not available

Natural source:   Common Name: SARS-CoV-2   Taxonomy ID: 2697049   Superkingdom: Viruses   Kingdom: not available   Genus/species: Betacoronavirus HCoV-SARS

Experimental source:   Production method: in vitro transcription   Host organism: Escherichia coli

Entity Sequences (FASTA):
entity_1: GGCACUCGGCUGCAUGCUUA GUGCC

Data sets:
Data typeCount
13C chemical shifts204
15N chemical shifts69
1H chemical shifts228
31P chemical shifts24

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
15_SL41

Entities:

Entity 1, 5_SL4 25 residues - Formula weight is not available

1   GGCACUCGGC
2   UGCAUGCUUA
3   GUGCC

Samples:

sample_1: 5_SL4short, [U-13C; U-15N ], 350 uM; potassium phosphate 25 mM; KCl 50 mM

sample_2: 5_SL4short, [U-13C; U-15N ], 350 uM; potassium phosphate 25 mM; KCl 50 mM

sample_conditions_1: ionic strength: 75 mM; pH: 6.2; pressure: 1 atm; temperature: 283 K

sample_conditions_2: ionic strength: 75 mM; pH: 6.2; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
HSQC[15N]-2Jsample_2isotropicsample_conditions_2
HSQC[15N]-Iminosample_1isotropicsample_conditions_1
HSQC[15N]-Aminosample_1isotropicsample_conditions_1
NOESY[15N]CPMGsample_1isotropicsample_conditions_1
HSQC[13C]sample_2isotropicsample_conditions_2
HSQC[13C]sample_2isotropicsample_conditions_2
NOESY HSQC [13C]sample_2isotropicsample_conditions_2
NOESY HSQC [13C]sample_2isotropicsample_conditions_2
H(N)COsample_1isotropicsample_conditions_1
H(C)P-TOCSYsample_2isotropicsample_conditions_2
H5(C5C4)N3sample_2isotropicsample_conditions_2
H5(C5C4)N3sample_2isotropicsample_conditions_2
H5(C5)C4sample_2isotropicsample_conditions_2
H6(C6N1)C2sample_2isotropicsample_conditions_2

Software:

LOGS v2.2 - collection

CARA v1.9.1.7 - chemical shift assignment, peak picking

TOPSPIN v4.0.6 - collection

NMR spectrometers:

  • Bruker Bruker Avance 600 MHz 600 MHz
  • Bruker Bruker Avance 800 MHz 800 MHz
  • Bruker Bruker Avance 900 MHz 900 MHz
  • Bruker Bruker Avance 950 MHz 950 MHz
  • Bruker Bruker Avance 700 MHz 700 MHz