BMRB Entry 50570
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50570
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Soni, Komal; Kempf, Georg; Manalastas-Cantos, Karen; Hendricks, Astrid; Flemming, Dirk; Guizetti, Julien; Simon, Bernd; Frischknecht, Friedrich; Svergun, Dmitri; Wild, Klemens; Sinning, Irmgard. "Structural analysis of the SRP Alu domain from Plasmodium falciparum reveals a non-canonical open conformation" Commun. Biol. 4, 600-600 (2021).
PubMed: 34017052
Assembly members:
entity_1, polymer, 30 residues, 9700 Da.
Natural source: Common Name: Plasmodium falciparum Taxonomy ID: 5833 Superkingdom: Eukaryota Kingdom: not available Genus/species: Plasmodium falciparum
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GGCUACUGUUCUUUUUAAGU
UCAGUAGCUC
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 15 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | Helix3 | 1 |
Entities:
Entity 1, Helix3 30 residues - 9700 Da.
| 1 | G | G | C | U | A | C | U | G | U | U | |
| 2 | C | U | U | U | U | U | A | A | G | U | |
| 3 | U | C | A | G | U | A | G | C | U | C |
Samples:
sample_1: PfAlu Helix3 275 uM; sodium phosphate 20 mM
sample_conditions_1: pH: 6.8; pressure: 1 atm; temperature: 277 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
Software:
ANALYSIS v2.4.2 - chemical shift assignment
NMR spectrometers:
- Bruker AVANCE III 800 MHz