BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 50339

Title: Assignment of base 15N and 1H chemical shifts for <5_SL5B+C>   PubMed: 33167030

Deposition date: 2020-06-23 Original release date: 2020-07-10

Authors: Schwalbe, Harald; Richter, Christian

Citation: Wacker, Anna; Weigand, Julia; Akabayov, Sabine; Altincekic, Nadide; Kaur Bains, Jasleen; Banijamali, Elnaz; Binas, Oliver; Castillo-Martinez, Jesus; Cetiner, Erhan; Ceylan, Betul; Chiu, Liang-Yuan; Davila-Calderon, Jesse; De Jesus, Vanessa; Dhamotharan, Karthikeyan; Duchardt-Ferner, Elke; Ferner, Jan; Frydman, Lucio; Furtig, Boris; Gallego, Jose; Grun, J. Tassilo; Hacker, Carolin; Haddad, Christina; Hahnke, Martin; Hengesbach, Martin; Hiller, Fabian; Hohmann, Katharina; Hymon, Daniel; Jonker, Henry; Keller, Heiko; Knezic, Bozana; Landgraf, Tom; Lohr, Frank; Luo, Luke; Mertinkus, Klara; Muhs, Christina; Novakovic, Mihajlo; Oxenfarth, Andreas; Palomino-Schatzlein, Martina; Petzold, Katja; Peter, Stephen; Pyper, Dennis; Qureshi, Nusrat; Riad, Magdalena; Richter, Christian; Saxena, Krishna; Schamber, Tatjana; Scherf, Tali; Schlagnitweit, Judith; Schlundt, Andreas; Schnieders, Robbin; Schwalbe, Harald; Simba-Lahuasi, Alvaro; Sreeramulu, Sridhar; Stirnal, Elke; Sudakov, Alexey; Tants, Jan-Niklas; Tolbert, Blanton; Vogele, Jenny; Weiss, Lena; Wirmer-Bartoschek, Julia; Wirtz Martin, Maria; Wohnert, Jens; Zetzsche, Heidi. "Secondary structure determination of conserved SARS-CoV-2 RNA elements by NMR spectroscopy"  Nucleic Acids Res. 48, 12415-12435 (2020).

Assembly members:
entity_1, polymer, 37 residues, Formula weight is not available

Natural source:   Common Name: SARS-CoV-2   Taxonomy ID: 2697049   Superkingdom: Viruses   Kingdom: not available   Genus/species: Betacoronavirus HCoV-SARS

Experimental source:   Production method: reverse transcriptase

Entity Sequences (FASTA):
entity_1: GCACAUCUAGGUUUCGUCCG GGUGUGACCGAAAGGUA

Data sets:
Data typeCount
15N chemical shifts15
1H chemical shifts14

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
15_SL5B+C1

Entities:

Entity 1, 5_SL5B+C 37 residues - Formula weight is not available

1   GCACAUCUAG
2   GUUUCGUCCG
3   GGUGUGACCG
4   AAAGGUA

Samples:

sample_1: 5_SL5B+C, [U-15N], 350 uM; potassium phosphate 25 mM; KCl 50 mM

sample_conditions_1: ionic strength: 75 mM; pH: 6.2; pressure: 1 atm; temperature: 283 K

Experiments:

NameSampleSample stateSample conditions
P_TROSY[15N]sample_1isotropicsample_conditions_1
1H-JR[15N]sample_1isotropicsample_conditions_1
HNN-COSY[15N]sample_1isotropicsample_conditions_1
HSQC[15N]-2Jsample_1isotropicsample_conditions_1
NOESY-JR[15N]-Aminosample_1isotropicsample_conditions_1
NOESY[15N]-Iminosample_1isotropicsample_conditions_1

Software:

LOGS v2.2 - collection

SPARKY v3.114 - chemical shift assignment, peak picking

TOPSPIN v4.0.7 - collection

NMR spectrometers:

  • Bruker Bruker Avance neo 600 MHz 600 MHz
  • Bruker Bruker Avance neo 1000 MHz 1000 MHz