Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR35028
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Trajkovski, Marko; Platella, Chiara; Musumeci, Domenica; Napolitano, Ettore; Esposito, Carla Lucia; Catuogno, Silvia; Plavec, Janez; Montesarchio, Daniela. "Unraveling the NMR structures of G-quadruplex-forming aptamers acting as inhibitors of High Mobility Group Box 1 (HMGB1) pathological activity" Int. J. Biol. Macromol. 357, 151585-151585 (2026).
PubMed: 41881226
Assembly members:
entity_1, polymer, 26 residues, 8209.282 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TTAGGGATTGGGAATGGGTA
TGGGTT
| Data type | Count |
| 1H chemical shifts | 243 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
Entity 1, unit_1 26 residues - 8209.282 Da.
| 1 | DT | DT | DA | DG | DG | DG | DA | DT | DT | DG | ||||
| 2 | DG | DG | DA | DA | DT | DG | DG | DG | DT | DA | ||||
| 3 | DT | DG | DG | DG | DT | DT |
sample_1: DNA (26-MER) 1.0 mM; potassium phosphate 20 mM; KCl 100 mM
sample_2: DNA (26-MER), NA-95%,U-5% 13C, U-5% 15N, 0.2 mM; potassium phosphate 20 mM; KCl 100 mM
sample_conditions_1: ionic strength: 120 mM; pH: 7.0; pressure: 1 bar; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_2 | isotropic | sample_conditions_1 |
NMRFAM-SPARKY, Lee W., Tonelli M., Makley J.L. - chemical shift assignment
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - structure calculation
TopSpin, Bruker Biospin - data analysis