Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_anomalous, AVS_full
BMRB Entry DOI: doi:10.13018/BMR34465
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Ahmed, M.; Marchanka, A.; Carlomagno, T.. "Structure of a Protein-RNA Complex by Solid-State NMR Spectroscopy
" Angew. Chem. Int. Ed. Engl. 59, 6866-6873 (2020).
PubMed: 32023357
Assembly members:
entity_1, polymer, 123 residues, 13414.664 Da.
entity_2, polymer, 26 residues, 8407.075 Da.
Natural source: Common Name: Pyrococcus furiosus Taxonomy ID: 2261 Superkingdom: Archaea Kingdom: not available Genus/species: Pyrococcus furiosus
Experimental source: Production method: recombinant technology Host organism: Escherichia coli BL21(DE3)
Entity Sequences (FASTA):
entity_1: MAKPSYVKFEVPKELAEKAL
QAVEIARDTGKIRKGTNETT
KAVERGQAKLVIIAEDVDPE
EIVAHLPPLCEEKEIPYIYV
PSKKELGAAAGIEVAAASVA
IIEPGKARDLVEEIAMKVKE
LMK
entity_2: GCUGAGCUCGAAAGAGCAAU
GAUGUC
| Data type | Count |
| 13C chemical shifts | 327 |
| 15N chemical shifts | 98 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
| 2 | entity_2 | 2 |
Entity 1, entity_1 123 residues - 13414.664 Da.
| 1 | MET | ALA | LYS | PRO | SER | TYR | VAL | LYS | PHE | GLU | ||||
| 2 | VAL | PRO | LYS | GLU | LEU | ALA | GLU | LYS | ALA | LEU | ||||
| 3 | GLN | ALA | VAL | GLU | ILE | ALA | ARG | ASP | THR | GLY | ||||
| 4 | LYS | ILE | ARG | LYS | GLY | THR | ASN | GLU | THR | THR | ||||
| 5 | LYS | ALA | VAL | GLU | ARG | GLY | GLN | ALA | LYS | LEU | ||||
| 6 | VAL | ILE | ILE | ALA | GLU | ASP | VAL | ASP | PRO | GLU | ||||
| 7 | GLU | ILE | VAL | ALA | HIS | LEU | PRO | PRO | LEU | CYS | ||||
| 8 | GLU | GLU | LYS | GLU | ILE | PRO | TYR | ILE | TYR | VAL | ||||
| 9 | PRO | SER | LYS | LYS | GLU | LEU | GLY | ALA | ALA | ALA | ||||
| 10 | GLY | ILE | GLU | VAL | ALA | ALA | ALA | SER | VAL | ALA | ||||
| 11 | ILE | ILE | GLU | PRO | GLY | LYS | ALA | ARG | ASP | LEU | ||||
| 12 | VAL | GLU | GLU | ILE | ALA | MET | LYS | VAL | LYS | GLU | ||||
| 13 | LEU | MET | LYS |
Entity 2, entity_2 26 residues - 8407.075 Da.
| 1 | G | C | U | G | A | G | C | U | C | G | ||||
| 2 | A | A | A | G | A | G | C | A | A | U | ||||
| 3 | G | A | U | G | U | C |
sample_1: 50S RIBOSOMAL PROTEIN L7AE (U-13C, U-15N), [U-99% 13C; U-99% 15N], 4 mg/mL; HEPES 25 mM; NaCl 120 mM
sample_2: 50S RIBOSOMAL PROTEIN L7AE (U-13C, U-15N), [U-99% 13C; U-99% 15N], 8 mg/mL; RNA (26-MER) 5 mg/mL; HEPES 25 mM; NaCl 120 mM
sample_3: 50S RIBOSOMAL PROTEIN L7AE (U-13C, U-15N), [U-99% 13C; U-99% 15N], 4 mg/mL; RNA (26-MER) 10 mg/mL; 50S RIBOSOMAL PROTEIN L7AE 12 mg/mL; HEPES 25 mM; NaCl 120 mM
sample_4: RNA (26-MER) 8 mg/mL; 50S RIBOSOMAL PROTEIN L7AE 16 mg/mL; RNA (26-MER) (U-13C, U-15N-ade), [U-13C; U-15N]-Ade, 2 mg/mL; HEPES 25 mM; NaCl 120 mM
sample_5: RNA (26-MER) 8 mg/mL; 50S RIBOSOMAL PROTEIN L7AE 16 mg/mL; RNA (26-MER) (U-13C, U-15N-ura), [U-13C; U-15N]-Ura, 2 mg/mL; HEPES 25 mM; NaCl 120 mM
sample_6: 50S RIBOSOMAL PROTEIN L7AE (U-13C, U-15N), [U-99% 13C; U-99% 15N], 4 mg/mL; RNA (26-MER) 10 mg/mL; 50S RIBOSOMAL PROTEIN L7AE 12 mg/mL; HEPES 25 mM; NaCl 120 mM
sample_7: RNA (26-MER) 8 mg/mL; 50S RIBOSOMAL PROTEIN L7AE 16 mg/mL; RNA (26-MER) (U-13C, U-15N-ade), [U-13C; U-15N]-Ade, 2 mg/mL; HEPES 25 mM; NaCl 120 mM
sample_8: RNA (26-MER) 8 mg/mL; 50S RIBOSOMAL PROTEIN L7AE 16 mg/mL; RNA (26-MER) (U-13C, U-15N-ura), [U-13C; U-15N]-Ura, 2 mg/mL; HEPES 25 mM; NaCl 120 mM
sample_9: 50S RIBOSOMAL PROTEIN L7AE (U-13C, U-15N), [U-99% 13C; U-99% 15N], 4 mg/mL; RNA (26-MER) 10 mg/mL; 50S RIBOSOMAL PROTEIN L7AE 12 mg/mL; HEPES 25 mM; NaCl 120 mM
sample_10: RNA (26-MER) 8 mg/mL; 50S RIBOSOMAL PROTEIN L7AE 16 mg/mL; RNA (26-MER) (U-13C, U-15N-ade), [U-13C; U-15N]-Ade, 2 mg/mL; HEPES 25 mM; NaCl 120 mM
sample_11: RNA (26-MER) 8 mg/mL; 50S RIBOSOMAL PROTEIN L7AE 16 mg/mL; RNA (26-MER) (U-13C, U-15N-ura), [U-13C; U-15N]-Ura, 2 mg/mL; HEPES 25 mM; NaCl 120 mM
sample_conditions_1: ionic strength: 150 mM; pH: 7.6; pressure: 1 bar; temperature: 265 K
sample_conditions_2: ionic strength: 150 mM; pH: 7.6; pressure: 1 bar; temperature: 260 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D NCA | sample_1 | anisotropic | sample_conditions_1 |
| 2D NCO | sample_1 | anisotropic | sample_conditions_1 |
| 2D 13C,13C DARR | sample_1 | anisotropic | sample_conditions_1 |
| 3D NCACX | sample_2 | anisotropic | sample_conditions_1 |
| 3D NCOCX | sample_2 | anisotropic | sample_conditions_1 |
| 2D 13C,13C DARR | sample_2 | anisotropic | sample_conditions_1 |
| 3D CANCO | sample_2 | anisotropic | sample_conditions_1 |
| 2D 13C,13C SPC53 | sample_2 | anisotropic | sample_conditions_1 |
| 2D 13C,13C SPC53 | sample_3 | anisotropic | sample_conditions_2 |
| 2D 13C,13C SPC53 | sample_4 | anisotropic | sample_conditions_2 |
| 2D 13C,13C SPC53 | sample_6 | anisotropic | sample_conditions_2 |
| 2D 13C,13C SPC53 | sample_5 | anisotropic | sample_conditions_2 |
| 2D 13C,13C SPC53 | sample_7 | anisotropic | sample_conditions_2 |
| 2D 13C,13C SPC53 | sample_8 | anisotropic | sample_conditions_2 |
| 2D 13C,13C SPC53 | sample_9 | anisotropic | sample_conditions_2 |
| 2D 13C,13C SPC53 | sample_10 | anisotropic | sample_conditions_2 |
| 2D 13C,13C SPC53 | sample_11 | anisotropic | sample_conditions_2 |
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement
HADDOCK, Bonvin - structure calculation
CARA, Keller and Wuthrich - chemical shift assignment, peak picking
TopSpin, Bruker Biospin - collection