BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34427

Title: Solution structure of the FUS/TLS RNA recognition motif in complex with U1 snRNA stem loop III

Deposition date: 2019-08-26 Original release date: 2020-10-23

Authors: Campagne, S.; Allain, F.

Citation: Campagne, S.; Allain, F.. "Solution structure of the FUS/TLS RNA recognition motif in complex with U1 snRNA stem loop III"  .

Assembly members:
entity_1, polymer, 131 residues, 14137.444 Da.
entity_2, polymer, 28 residues, 8954.375 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli BL21(DE3)

Entity Sequences (FASTA):
entity_1: GGFNKFGGPRDQGSRHDSEQ DNSDNNTIFVQGLGENVTIE SVADYFKQIGIIKTNKKTGQ PMINLYTDRETGKLKGEATV SFDDPPSAKAAIDWFDGKEF SGNPIKVSFATRRADFNRGG GNGRGGRGRGG
entity_2: GGGAUUUCCCCAAAUGUGGG AAACUCCC

Data typeCount
13C chemical shifts641
15N chemical shifts139
1H chemical shifts981

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11
2entity_22

Entities:

Entity 1, entity_1 131 residues - 14137.444 Da.

1   GLYGLYPHEASNLYSPHEGLYGLYPROARG
2   ASPGLNGLYSERARGHISASPSERGLUGLN
3   ASPASNSERASPASNASNTHRILEPHEVAL
4   GLNGLYLEUGLYGLUASNVALTHRILEGLU
5   SERVALALAASPTYRPHELYSGLNILEGLY
6   ILEILELYSTHRASNLYSLYSTHRGLYGLN
7   PROMETILEASNLEUTYRTHRASPARGGLU
8   THRGLYLYSLEULYSGLYGLUALATHRVAL
9   SERPHEASPASPPROPROSERALALYSALA
10   ALAILEASPTRPPHEASPGLYLYSGLUPHE
11   SERGLYASNPROILELYSVALSERPHEALA
12   THRARGARGALAASPPHEASNARGGLYGLY
13   GLYASNGLYARGGLYGLYARGGLYARGGLY
14   GLY

Entity 2, entity_2 28 residues - 8954.375 Da.

1   GGGAUUUCCC
2   CAAAUGUGGG
3   AAACUCCC

Samples:

sample_1: FUS/TLS RNA recognition motif (260-390), [U-99% 13C; U-99% 15N], 1.2 mM; SL3 1.5 mM; sodium phosphate 10 mM; sodium chloride 50 mM; DTT 2 mM

sample_2: FUS/TLS RNA recognition motif (260-390), [U-99% 13C; U-99% 15N], 1.2 mM; SL3 1.5 mM; sodium phosphate 10 mM; sodium chloride 50 mM; DTT 2 mM

sample_3: FUS/TLS RNA recognition motif (260-390) 1 mM; SL3, [U-13C; U-15N], 0.8 mM; sodium phosphate 10 mM; sodium chloride 50 mM; DTT 2 mM

sample_4: FUS/TLS RNA recognition motif (260-390) 1 mM; SL3 1 mM; sodium phosphate 10 mM; sodium chloride 50 mM; DTT 2 mM

sample_conditions_1: ionic strength: 60 mM; pH: 6.8; pressure: 1 atm; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-13C HSQC aliphaticsample_1isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_1isotropicsample_conditions_1
2D 1H-13C HSQC aliphaticsample_2isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_2isotropicsample_conditions_1
3D HCCH-TOCSYsample_3isotropicsample_conditions_1
3D 1H-13C NOESYsample_3isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_3isotropicsample_conditions_1
2D 1H-13C HSQC aliphaticsample_3isotropicsample_conditions_1
3D 1H-13C NOESY aromaticsample_2isotropicsample_conditions_1
3D 1H-13C NOESY aliphaticsample_2isotropicsample_conditions_1
3D 1H-13C NOESY aromaticsample_1isotropicsample_conditions_1
3D 1H-13C NOESY aliphaticsample_1isotropicsample_conditions_1
3D 1H-15N NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_4isotropicsample_conditions_1
3D HNCAsample_1isotropicsample_conditions_1
3D HNCOsample_1isotropicsample_conditions_1
3D CBCA(CO)NHsample_1isotropicsample_conditions_1
3D HNCACBsample_1isotropicsample_conditions_1
2D F1fF2F TOCSYsample_2isotropicsample_conditions_1
2D F2F NOEYsample_2isotropicsample_conditions_1
2D F1FF2f NOESYsample_2isotropicsample_conditions_1
3D 1H-13C filtered edited NOESY HSQCsample_3isotropicsample_conditions_1
3D 1H-13C filtered edited NOESY HSQCsample_2isotropicsample_conditions_1

Software:

Amber v12, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement

CYANA v3.98, Guntert, Mumenthaler and Wuthrich - structure calculation

CARA, Keller and Wuthrich - chemical shift assignment

CYANA, Guntert, Mumenthaler and Wuthrich - peak picking

NMR spectrometers:

  • Bruker AVANCE III 600 MHz
  • Bruker AVANCE III 700 MHz
  • Bruker AVANCE 900 MHz

Download simulated HSQC data in one of the following formats:
CSV: Backbone or all simulated shifts
SPARKY: Backbone or all simulated shifts