Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR31254
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Dickerhoff, J.; Yang, D.. "NMR Structure Study of DNA G-quadruplexes and Ligand Interactions" .
Assembly members:
entity_1, polymer, 24 residues, 7600.897 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TAGGGTTAGGGTTAGGGTTA
GGGA
| Data type | Count |
| 13C chemical shifts | 288 |
| 1H chemical shifts | 459 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
Entity 1, unit_1 24 residues - 7600.897 Da.
| 1 | DT | DA | DG | DG | DG | DT | DT | DA | DG | DG | ||||
| 2 | DG | DT | DT | DA | DG | DG | DG | DT | DT | DA | ||||
| 3 | DG | DG | DG | DA |
sample_1: DNA (5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*A)-3') 1.9 mM; potassium cyanide 10 mM
sample_conditions_1: ionic strength: 10 mM; pH: 7; pressure: 1 atm; temperature: 298 K
sample_conditions_2: ionic strength: 10 mM; pH: 7; pressure: 1 atm; temperature: 288 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D DQF-COSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HMBC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_2 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_2 |
TopSpin, Bruker Biospin - processing
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, and Kollman - refinement, structure calculation
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - structure calculation
CcpNmr Analysis, CCPN - chemical shift assignment, peak picking