BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 30868

Title: Solution structure of the HIV-1 PBS-segment

Deposition date: 2021-02-24 Original release date: 2021-03-12

Authors: Heng, X.; Song, Z.

Citation: Song, Z.; Heng, X.. "Structure of the HIV-1 PBS-segment is conserved for viral infectivity"  .

Assembly members:
entity_1, polymer, 103 residues, 33249.836 Da.

Natural source:   Common Name: HIV-1   Taxonomy ID: 11676   Superkingdom: Viruses   Kingdom: not available   Genus/species: Lentivirus HIV-1

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: GGCUCUGGUAACUAGAGAUC CCUCAGACCCUUUUAGUCAG UGUGGAAAAUCUCUAGCAGU GGCGCCCGAACAGGGACUUG AAAGCGAAAGUAAAGCCAGA GCC

Data sets:
Data typeCount
1H chemical shifts474

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1unit_11

Entities:

Entity 1, unit_1 103 residues - 33249.836 Da.

1   GGCUCUGGUA
2   ACUAGAGAUC
3   CCUCAGACCC
4   UUUUAGUCAG
5   UGUGGAAAAU
6   CUCUAGCAGU
7   GGCGCCCGAA
8   CAGGGACUUG
9   AAAGCGAAAG
10   UAAAGCCAGA
11   GCC

Samples:

sample_1: RNA (103-MER), 1H, 250 uM

sample_2: RNA (103-MER), [A-8D, C-D, G-H, U-5,6-D2], 250 uM

sample_3: RNA (103-MER), [A-8D, C-D, G-8D, U-H], 250 uM

sample_4: RNA (103-MER), [A-8D, C-5,6-D2, G-D, U-5,6-D2], 250 uM

sample_5: RNA (103-MER), [A-8D, C-D, G-8D, U-D], 250 uM

sample_6: RNA (103-MER), [A-H, C-D, G-H, U-D], 250 uM

sample_7: RNA (103-MER), [A-H, C-H, G-D, U-D], 250 uM

sample_conditions_1: ionic strength: 3 mM; pH: 7.5 pD; pressure: 1 atm; temperature: 308 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D 1H-1H NOESYsample_3isotropicsample_conditions_1
2D 1H-1H NOESYsample_4isotropicsample_conditions_1
2D 1H-1H NOESYsample_5isotropicsample_conditions_1
2D 1H-1H NOESYsample_6isotropicsample_conditions_1
2D 1H-1H NOESYsample_7isotropicsample_conditions_1

Software:

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

NMRView, Johnson, One Moon Scientific - chemical shift assignment, peak picking

CYANA, Guntert, Mumenthaler and Wuthrich - geometry optimization, structure calculation

Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, and Kollman - refinement

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement

NMR spectrometers:

  • Bruker AVANCE 800 MHz