Chem Shift validation: AVS_full, LACS
BMRB Entry DOI: doi:10.13018/BMR19908
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Moschen, Thomas; Wunderlich, Christoph; Kreutz, Christoph; Tollinger, Martin. "NMR resonance assignments of the archaeal ribosomal protein L7Ae in the apo form and bound to a 25 nt RNA
" Biomol. NMR Assign. 9, 177-180 (2015).
PubMed: 25030110
Assembly members:
L7Ae_complex, polymer, 121 residues, 13123.3 Da.
25_nt_C/D-box_RNA_mimic, polymer, 25 residues, 8075.93 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
L7Ae_complex: RGSHMAVYVKFKVPEEIQKE
LLDAVAKAQKIKKGANEVTK
AVERGIAKLVIIAEDVKPEE
VVAHLPYLCEEKGIPYAYVA
SKQDLGKAAGLEVAASSVAI
INEGDAEELKVLIEKVNVLK
Q
25_nt_C/D-box_RNA_mimic: GCUCUGACCGAAAGGCGUGA
UGAGC
| Data type | Count |
| 13C chemical shifts | 326 |
| 15N chemical shifts | 111 |
| 1H chemical shifts | 210 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | L7Ae | 1 |
| 2 | 25nt C/D box mimic | 2 |
Entity 1, L7Ae 121 residues - 13123.3 Da.
first 4 residues are left from cleavage with thrombin
| 1 | ARG | GLY | SER | HIS | MET | ALA | VAL | TYR | VAL | LYS | ||||
| 2 | PHE | LYS | VAL | PRO | GLU | GLU | ILE | GLN | LYS | GLU | ||||
| 3 | LEU | LEU | ASP | ALA | VAL | ALA | LYS | ALA | GLN | LYS | ||||
| 4 | ILE | LYS | LYS | GLY | ALA | ASN | GLU | VAL | THR | LYS | ||||
| 5 | ALA | VAL | GLU | ARG | GLY | ILE | ALA | LYS | LEU | VAL | ||||
| 6 | ILE | ILE | ALA | GLU | ASP | VAL | LYS | PRO | GLU | GLU | ||||
| 7 | VAL | VAL | ALA | HIS | LEU | PRO | TYR | LEU | CYS | GLU | ||||
| 8 | GLU | LYS | GLY | ILE | PRO | TYR | ALA | TYR | VAL | ALA | ||||
| 9 | SER | LYS | GLN | ASP | LEU | GLY | LYS | ALA | ALA | GLY | ||||
| 10 | LEU | GLU | VAL | ALA | ALA | SER | SER | VAL | ALA | ILE | ||||
| 11 | ILE | ASN | GLU | GLY | ASP | ALA | GLU | GLU | LEU | LYS | ||||
| 12 | VAL | LEU | ILE | GLU | LYS | VAL | ASN | VAL | LEU | LYS | ||||
| 13 | GLN |
Entity 2, 25nt C/D box mimic 25 residues - 8075.93 Da.
25 nucleotide C/D box mimic k-turn RNA
| 1 | G | C | U | C | U | G | A | C | C | G | ||||
| 2 | A | A | A | G | G | C | G | U | G | A | ||||
| 3 | U | G | A | G | C |
sample: L7Ae_complex, [U-100% 13C; U-100% 15N], 1 mM; 25 nt C/D-box RNA mimic 1 mM; D2O, [U-100% 2H], 10%; sodium cacodylate 10 mM; potassium chloride 50 mM; H2O 90%
sample_conditions: pH: 6.5; pressure: 1 atm; temperature: 273 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample | isotropic | sample_conditions |
| 2D 1H-13C HSQC | sample | isotropic | sample_conditions |
| 3D HNCO | sample | isotropic | sample_conditions |
| 3D HNCA | sample | isotropic | sample_conditions |
| 3D HNCACB | sample | isotropic | sample_conditions |
| 3D CBCA(CO)NH | sample | isotropic | sample_conditions |
| 3D HN(CO)CA | sample | isotropic | sample_conditions |
| 3D 15N-TOCSY-HSQC | sample | isotropic | sample_conditions |
CCPN, CCPN - chemical shift assignment
TALOS, Cornilescu, Delaglio and Bax - processing
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
Download HSQC peak lists in one of the following formats:
CSV: Backbone
or all simulated peaks
SPARKY: Backbone
or all simulated peaks