Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR7098
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Ulyanov, N.; Mujeeb, A.; Du, Z.; Tonelli, M.; Parslow, T.; James, T.. "NMR structure of the full-length linear dimer of stem-loop-1 RNA in the HIV-1
dimer initiation site
" J. Biol. Chem. 281, 16168-16177 (2006).
PubMed: 16603544
Assembly members:
RNA (35-MER), polymer, 35 residues, Formula weight is not available
Natural source: Common Name: HIV-1 Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV-1
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
RNA (35-MER): GACGGCUUGCUGAAGCGCGC
ACGGCAAGAGGCGUC
| Data type | Count |
| 13C chemical shifts | 137 |
| 15N chemical shifts | 11 |
| 1H chemical shifts | 181 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA (35-MER), chain A | 1 |
| 2 | RNA (35-MER), chain B | 1 |
Entity 1, RNA (35-MER), chain A 35 residues - Formula weight is not available
| 1 | G | A | C | G | G | C | U | U | G | C | ||||
| 2 | U | G | A | A | G | C | G | C | G | C | ||||
| 3 | A | C | G | G | C | A | A | G | A | G | ||||
| 4 | G | C | G | U | C |
sample_1: RNA (35-MER) 0.75 mM; potassium phosphate buffer 10 mM; NaCl 250 mM; MgCl2 0.1 mM; D2O 100%
sample_2: RNA (35-MER) 0.75 mM; potassium phosphate buffer 10 mM; NaCl 250 mM; MgCl2 0.1 mM; H2O 90%; D2O 10%
sample_3: RNA (35-MER), [U-13C; U-15N], 0.75 mM; potassium phosphate buffer 10 mM; NaCl 250 mM; MgCl2 0.1 mM; D2O 100%
sample_4: RNA (35-MER), [U-13C; U-15N], 0.75 mM; potassium phosphate buffer 10 mM; NaCl 250 mM; MgCl2 0.1 mM; H2O 90%; D2O 10%
sample_cond_1: ionic strength: 260 mM; pH: 6.4; pressure: 1 atm; temperature: 303 K
sample_cond_2: ionic strength: 260 mM; pH: 6.4; pressure: 1 atm; temperature: 288 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D NOESY | not available | not available | not available |
| 2D TOCSY | not available | not available | not available |
| 3D 13C-separated NOESY | not available | not available | not available |
| non-decoupled constant-time 1H-13C TROSY-HSQC | not available | not available | not available |
| 2D 1H-15N HSQC | not available | not available | not available |
VNMR v6.1 - collection
NMRPipe v2.3 - processing
MARDIGRAS v3.21 - iterative matrix relaxation
SPARKY v3.110 - data analysis
DYANA v1.5 - refinement
miniCarlo - refinement