BMRB Entry 6062

Click here to enlarge.

PDB ID: 1s2f
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6062
MolProbity Validation Chart

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry

Title:
Assignments for the Negative Regulator of Splicing from Rous Sarcoma Virus residues 907 to 929
Deposition date:
2004-01-06
Original release date:
2004-10-29
Authors:
Cabello-Villegas, Javier; Guiles, Keith; Soto, Ana; Yu, Ping; Beemon, Karen; Wang, Yun-Xing
Citation:

Citation: Cabello-Villegas, Javier; Giles, Keith; Soto, Ana; Yu, Ping; Mougin, A.; Beemon, Karen; Wang, Yun-Xing. "Solution structure of the pseudo-5' splice site of a retroviral splicing suppressor"  RNA 10, 1388-1398 (2004).
PubMed: 15317975

Assembly members:

Assembly members:
RNA stem-loop, polymer, 23 residues, Formula weight is not available

Natural source:

Natural source:   Common Name: Rous sarcoma virus   Taxonomy ID: 11886   Superkingdom: Viruses   Kingdom: not available   Genus/species: alpharetrovirus Rous sarcoma virus

Experimental source:

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
RNA stem-loop: GGGGAGUGGUUUGUAUCCUU CCC

Data sets:
Data typeCount
13C chemical shifts153
15N chemical shifts15
31P chemical shifts17

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all