Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6042
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Ohlenschlager, O.; Wohnert, J.; Bucci, E.; Seitz, S.; Hafner, S.; Ramachandran, R.; Zell, R.; Gorlach, M.. "The Structure of the Stemloop D Subdomain of Coxsackievirus B3 Cloverleaf RNA
and its Interaction with the Proteinase 3C
" Stucture 12, 237-248 (2004).
PubMed: 14962384
Assembly members:
SLD-RNA, polymer, 30 residues, Formula weight is not available
Natural source: Common Name: COXSACKIEVIRUS B3 Taxonomy ID: 12072 Superkingdom: Viruses Kingdom: not available Genus/species: Enterovirus Human enterovirus B
Experimental source: Production method: recombinant technology
Entity Sequences (FASTA):
SLD-RNA: GGCACUCUGGUAUCACGGUA
CCUUUGUGUC
| Data type | Count |
| coupling constants | 14 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | SLD-RNA | 1 |
Entity 1, SLD-RNA 30 residues - Formula weight is not available
| 1 | G | G | C | A | C | U | C | U | G | G | |
| 2 | U | A | U | C | A | C | G | G | U | A | |
| 3 | C | C | U | U | U | G | U | G | U | C |
sample_1: SLD-RNA, [U-13C; U-15N], 0.9 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; H2O 95%; D2O 5%
sample_2: SLD-RNA, [U-13C; U-15N], 0.9 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; D2O 99.99%
sample_3: SLD-RNA, [U-13C; U-15N]-G, C, 1.2 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; H2O 95%; D2O 5%
sample_4: SLD-RNA, [U-13C; U-15N]-G, C, 1.2 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; D2O 99.99%
sample_5: SLD-RNA, [U-13C; U-15N]-A, U, 1.2 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; H2O 95%; D2O 5%
sample_6: SLD-RNA, [U-13C; U-15N]-A, U, 1.2 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; D2O 99.99%
sample_7: SLD-RNA, [U-15N], 1.4 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; H2O 95%; D2O 5%
sample_8: SLD-RNA, [U-15N], 1.2 mM; KH2PO4/K2HPO4 10 mM; KCl 40 mM; EDTA 0.2 mM; D2O 99.99%
sample_cond_1: ionic strength: 50 mM; pH: 6.2; pressure: 1 atm; temperature: 298 K
sample_cond_2: ionic strength: 50 mM; pH: 6.2; pressure: 1 atm; temperature: 283 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| not available | not available | not available | not available |
VNMR v6.1, rev. c - collection, processing
XEASY v1.3.9 - data analysis
FOUND vimplemented in CYANA-1.0.6 - structure solution
CYANA v1.0.6 - structure solution
OPAL v2.6 - refinement