Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5962
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Sigel, Roland; Sashital, Dipali; Abramowitz, Dana; Palmer, Arthur; Butcher, Samuel; Pyle, Anna Marie. "Solution structure of domain 5 of a group II intron ribozyme reveals a new
RNA motif
" Nat. Struct. Mol. Biol. 11, 187-192 (2004).
PubMed: 14745440
Assembly members:
Domain 5, polymer, 36 residues, 12297 Da.
Natural source: Common Name: Baker's yeast Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae
Experimental source: Production method: cell free synthesis
Entity Sequences (FASTA):
Domain 5: GGAGCCGUAUGCGAUGAAAG
UCGCACGUACGGUUCC
| Data type | Count |
| 13C chemical shifts | 97 |
| 15N chemical shifts | 41 |
| 1H chemical shifts | 272 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | wildtype domain 5 hairpin | 1 |
Entity 1, wildtype domain 5 hairpin 36 residues - 12297 Da.
| 1 | G | G | A | G | C | C | G | U | A | U | ||||
| 2 | G | C | G | A | U | G | A | A | A | G | ||||
| 3 | U | C | G | C | A | C | G | U | A | C | ||||
| 4 | G | G | U | U | C | C |
sample_1: Domain 5, [U-13C; U-15N], 0.4 0.7 mM; KCl 100 mM; Edta 10 micM
cond_1: ionic strength: 0.11 mM; pH: 6.7; pressure: 1 atm; temperature: 303 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 1H,1H NOESY | sample_1 | not available | cond_1 |
| 3D-13C separated NOESY | sample_1 | not available | cond_1 |
| 2D 1H-13C HSQC | sample_1 | not available | cond_1 |
| 2D 1H-1H TOCSY | sample_1 | not available | cond_1 |
| 3D 1H-13C-1H HCCH TOCSY | sample_1 | not available | cond_1 |
| 3D 1H-13C-1H HCCH COSY | sample_1 | not available | cond_1 |
| 2D 2JHN HNN-COSY | sample_1 | not available | cond_1 |
xwinnmr v2.6 - processing
SPARKY v3 - data analysis