Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_anomalous, AVS_full, LACS
BMRB Entry DOI: doi:10.13018/BMR5345
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Kalodimos, Charalampos; Bonvin, A.; Salinas, R.; Wechselberger, R.; Boelens, R.; Kaptein, R.. "PLASTICITY IN PROTEIN-DNA RECOGNITION: LAC REPRESSOR INTERACTS WITH ITS NATURAL
OPERATOR THROUGH ALTERNATIVE CONFORMATIONS OF ITS DNA-BINDING DOMAIN
" EMBO J. 21, 2866-2876 (2002).
PubMed: 12065400
Assembly members:
lactose repressor-operator, polymer, 62 residues, 7000 Da.
lactose repressor-operator DNA, polymer, 23 residues, Formula weight is not available
lactose repressor-operator DNA, polymer, 23 residues, Formula weight is not available
Natural source: Common Name: E. coli Taxonomy ID: 562 Superkingdom: Eubacteria Kingdom: not available Genus/species: Escherichia coli
Experimental source: Production method: recombinant technology
Entity Sequences (FASTA):
lactose repressor-operator: MKPVTLYDVAEYAGVSYQTV
SRVVNQASHVSAKTREKVEA
AMAELNYIPNRCAQQLAGKQ
SL
lactose repressor-operator DNA: GAATTGTGAGCGGATAACAA
TTT
lactose repressor-operator DNA: AAATTGTTATCCGCTCACAA
TTC
| Data type | Count |
| 13C chemical shifts | 458 |
| 1H chemical shifts | 1207 |
| 15N chemical shifts | 138 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | Lactose operon repressor, chain A | 1 |
| 2 | Lactose operon repressor, chain B | 1 |
| 3 | LAC-DNA, chain A | 2 |
| 4 | LAC-DNA, chain B | 3 |
Entity 1, Lactose operon repressor, chain A 62 residues - 7000 Da.
| 1 | MET | LYS | PRO | VAL | THR | LEU | TYR | ASP | VAL | ALA | ||||
| 2 | GLU | TYR | ALA | GLY | VAL | SER | TYR | GLN | THR | VAL | ||||
| 3 | SER | ARG | VAL | VAL | ASN | GLN | ALA | SER | HIS | VAL | ||||
| 4 | SER | ALA | LYS | THR | ARG | GLU | LYS | VAL | GLU | ALA | ||||
| 5 | ALA | MET | ALA | GLU | LEU | ASN | TYR | ILE | PRO | ASN | ||||
| 6 | ARG | CYS | ALA | GLN | GLN | LEU | ALA | GLY | LYS | GLN | ||||
| 7 | SER | LEU |
Entity 2, LAC-DNA, chain A 23 residues - Formula weight is not available
| 1 | DG | DA | DA | DT | DT | DG | DT | DG | DA | DG | ||||
| 2 | DC | DG | DG | DA | DT | DA | DA | DC | DA | DA | ||||
| 3 | DT | DT | DT |
Entity 3, LAC-DNA, chain B 23 residues - Formula weight is not available
| 1 | DA | DA | DA | DT | DT | DG | DT | DT | DA | DT | ||||
| 2 | DC | DC | DG | DC | DT | DC | DA | DC | DA | DA | ||||
| 3 | DT | DT | DC |
sample_1: lactose repressor-operator, [U-15N; U-13C], 4 mM; lactose repressor-operator DNA 2 mM; lactose repressor-operator DNA 2 mM; KPi 10 mM; KCl 20 mM; D2O 10%; H2O 90%
sample_cond_1: pH: 6.0 na; temperature: 315 K; ionic strength: 30 mM; pressure: 1 atm
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 3D 13C-separated NOESY | sample_1 | not available | sample_cond_1 |
| 3D 15N-separated NOESY | sample_1 | not available | sample_cond_1 |
| 2D NOESY | sample_1 | not available | sample_cond_1 |
XWINNMR v3.1 - collection
NMRPipe v1.0 - processing
NMRView v5.0.4 - data analysis
CNS v1.1 - structure solution, refinement
| BMRB | 1066 127 1494 1552 32 4813 5791 661 736 848 849 96 |
| PDB | |
| DBJ | BAB20667 BAB33821 BAD00175 BAD20286 BAD20288 |
| EMBL | CAA07594 CAA07597 CAA11118 CAA11119 CAA11120 |
| GB | AAA24052 AAA56744 AAA56768 AAA57088 AAA57091 |
| REF | NP_286086 NP_414879 WP_000718174 WP_000805876 WP_000805884 |
| SP | P03023 |
| AlphaFold | P03023 |
Download HSQC peak lists in one of the following formats:
CSV: Backbone
or all simulated peaks
SPARKY: Backbone
or all simulated peaks