BMRB Entry 4226
Click here to enlarge.
PDB ID: 1ldz
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR4226
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Legault, P.; Hoogstraten, C.; Metlitzky, E.; Pardi, A.. "Order, Dynamics, and Metal-Binding in the Lead-Dependent Ribozyme" J. Mol. Biol. 284, 325-335 (1998).
Assembly members:
lead-dependent ribozyme, polymer, 30 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: cell free synthesis
Entity Sequences (FASTA):
lead-dependent ribozyme: GCGACCGAGCCAGCGAAAGU
UGGGAGUCGC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 206 |
| 15N chemical shifts | 92 |
| 1H chemical shifts | 278 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | lead-dependent ribozyme | 1 |
Entities:
Entity 1, lead-dependent ribozyme 30 residues - Formula weight is not available
| 1 | G | C | G | A | C | C | G | A | G | C | |
| 2 | C | A | G | C | G | A | A | A | G | U | |
| 3 | U | G | G | G | A | G | U | C | G | C |