Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR36393
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Obayashi, C.; Shinohara, Y.; Masuda, T.; Kawai, G.. "Influence of the 5'-terminal sequences on the 5'-UTR structure of HIV-1 genomic RNA.
" Sci. Rep. 11, 10920-10920 (2021).
PubMed: 34035384
Assembly members:
RNA (36-MER), polymer, 36 residues, 11558.872 Da.
Natural source: Common Name: not available Taxonomy ID: 11676 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis Host organism: unidentified
Entity Sequences (FASTA):
RNA (36-MER): GGUCUCUCUUCGGGGAACCC
ACUGCGAAAGUAGUGU
| Data type | Count |
| 1H chemical shifts | 162 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entity 1, entity_1 36 residues - 11558.872 Da.
| 1 | G | G | U | C | U | C | U | C | U | U | ||||
| 2 | C | G | G | G | G | A | A | C | C | C | ||||
| 3 | A | C | U | G | C | G | A | A | A | G | ||||
| 4 | U | A | G | U | G | U |
sample_1: RNA (36-MER), [U-10% 13C; U-15N], 100 uM; sodium chloride 50 mM; sodium phosphate 20 mM; H2O 95%; D2O, [U-2H], 5%
sample_conditions_1: ionic strength: 50 mM; pH: 6.5; pressure: 1 atm; temperature: 283 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D HOHAHA | sample_1 | isotropic | sample_conditions_1 |
| 2D NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D HOHAHA | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
CNS v1.3, Brunger, Adams, Clore, Gros, Nilges and Read - structure calculation
Sparky, Goddard - chemical shift assignment
Sparky, Goddard - peak picking