Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR36160
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Liu, Wenting; Zhong, Yi-Fang; Liu, Liu-Yi; Shen, Chu-Tong; Zeng, Wenjuan; Wang, Fuyi; Yang, Danzhou; Mao, Zong-Wan. "Solution structures of multiple G-quadruplex complexes induced by a platinum(II)-based tripod reveal dynamic binding
" Nat. Commun. 9, 3496-3496 (2018).
PubMed: 30158518
Assembly members:
G-quadruplex DNA (26-MER), polymer, 26 residues, 8236.324 Da.
4-[1-(2,5,8-triazonia-1$l^4-platinabicyclo[3.3.0]octan-1-yl)pyridin-1-ium-4-yl]-N,N-bis[4-[1-(2,5,8-triazonia-1$l^4-platinabicyclo[3.3.0]octan-1-yl)pyridin-1-ium-4-yl]phenyl]aniline
, non-polymer, 1371.303 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
G-quadruplex DNA (26-MER): AAAGGGTTAGGGTTAGGGTT
AGGGAA
| Data type | Count |
| 1H chemical shifts | 388 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1, 1 | 1 |
| 2 | entity_1, 2 | 1 |
| 3 | entity_9F0, 1 | 2 |
| 4 | entity_9F0, 2 | 2 |
| 5 | entity_9F0, 3 | 2 |
| 6 | entity_9F0, 4 | 2 |
Entity 1, entity_1, 1 26 residues - 8236.324 Da.
| 1 | DA | DA | DA | DG | DG | DG | DT | DT | DA | DG | ||||
| 2 | DG | DG | DT | DT | DA | DG | DG | DG | DT | DT | ||||
| 3 | DA | DG | DG | DG | DA | DA |
Entity 2, entity_9F0, 1 - C45 H63 N13 Pt3 - 1371.303 Da.
| 1 | 9F0 |
sample_1: G-quadruplex DNA (26-MER), [U-15N]-Thy, 1 mM; Pt-tripod 3 mM; potassium chloride 70 mM; potassium phosphate 25 mM; H2O 90%; D2O, [U-2H], 10%
sample_2: G-quadruplex DNA (26-MER) 1 mM; Pt-tripod 3 mM; potassium chloride 70 mM; potassium phosphate 25 mM; H2O 90%; D2O, [U-2H], 10%
sample_conditions_1: ionic strength: 95 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K
sample_conditions_2: ionic strength: 95 mM; pH: 7.0; pressure: 1 atm; temperature: 288 K
sample_conditions_3: ionic strength: 95 mM; pH: 7.0; pressure: 1 atm; temperature: 278 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_2 | anisotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_2 | anisotropic | sample_conditions_1 |
| 2D 1H-1H COSY | sample_2 | anisotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | anisotropic | sample_conditions_2 |
| 2D 1H-1H TOCSY | sample_2 | anisotropic | sample_conditions_2 |
| 2D 1H-1H COSY | sample_2 | anisotropic | sample_conditions_2 |
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_3 |
DISCOVER, Accelrys Software Inc. - structure calculation
SPARKY, Goddard - chemical shift assignment, peak picking
TOPSPIN, Bruker Biospin - processing
X-PLOR, Brunger - refinement