Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34900
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Vianney, Y.; Jana, J.; Weisz, K.. "A pH-Responsive Topological Switch Based on a DNA Quadruplex-Duplex Hybrid" Chemistry ., .-. (2024).
PubMed: 38497675
Assembly members:
entity_1, polymer, 33 residues, 10467.536 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: synthetic construct
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGCGCGAAGCATTCGCGGG
GTTAGXGTTAGGG
Data type | Count |
13C chemical shifts | 46 |
1H chemical shifts | 205 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
Entity 1, unit_1 33 residues - 10467.536 Da.
1 | DG | DG | DG | DC | DG | DC | DG | DA | DA | DG | ||||
2 | DC | DA | DT | DT | DC | DG | DC | DG | DG | DG | ||||
3 | DG | DT | DT | DA | DG | BGM | DG | DT | DT | DA | ||||
4 | DG | DG | DG |
sample_1: DNA (33-MER) 0.3 mM; DNA (33-MER), [U-10% 13C; U-10% 15N] deoxyguanosine, 0.2 mM; potassium phosphate buffer 20 mM; KCl 100 mM
sample_conditions_1: ionic strength: 120 mM; pH: 7.9; pressure: 1 atm; temperature: 298 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H COSY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
1H-15N HMQC | sample_1 | isotropic | sample_conditions_1 |
CcpNmr Analysis v2.4.2, CCPN - chemical shift assignment, peak picking
Amber v18, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement, structure calculation
TopSpin v4.0.7, Bruker Biospin - processing