BMRB Entry 34685

Title:
Solution structure of a lanthanide-binding DNA aptamer
Deposition date:
2021-11-18
Original release date:
2021-11-28
Authors:
Andralojc, W.; Gdaniec, Z.
Citation:

Citation: Andralojc, W.; Wieruszewska, J.; Pasternak, K.; Gdaniec, Z.. "Solution Structure of a Lanthanide-binding DNA Aptamer Determined Using High Quality pseudocontact shift restraints "  Chemistry 28, e202202114-e202202114 (2022).
PubMed: 36043489

Assembly members:

Assembly members:
entity_1, polymer, 28 residues, 8642.544 Da.
entity_LU, non-polymer, 174.967 Da.

Natural source:

Natural source:   Common Name: not available   Taxonomy ID: 32630   Superkingdom: not available   Kingdom: not available   Genus/species: synthetic construct

Experimental source:

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
entity_1: CGGCCGTCGAAGACCCGCGA AGTGGCCG

Data typeCount
1H chemical shifts779
31P chemical shifts79

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1unit_11
2unit_22

Entities:

Entity 1, unit_1 28 residues - 8642.544 Da.

1   DCDGDGDCDCDGDTDCDGDA
2   DADGDADCDCDCDGDCDGDA
3   DADGDTDGDGDCDCDG

Entity 2, unit_2 - Lu - 174.967 Da.

1   LU

Samples:

sample_1: Lanthanide-binding aptamer 700 ± 35 uM; cacodylate 10 ± 0.5 mM; sodium chloride 150 ± 7.5 mM; Lutetium chloride 700 ± 35 uM

sample_2: Lanthanide-binding aptamer 700 ± 35 uM; cacodylate 10 ± 0.5 mM; sodium chloride 150 ± 7.5 mM; Europium chloride 700 ± 35 uM

sample_3: Lanthanide-binding aptamer 700 ± 35 uM; cacodylate 10 ± 0.5 mM; sodium chloride 150 ± 7.5 mM; Ytterbium acetate 700 ± 35 uM

sample_4: Lanthanide-binding aptamer 700 ± 35 uM; cacodylate 10 ± 0.5 mM; sodium chloride 150 ± 7.5 mM; cerium chloride 700 ± 35 uM

sample_5: Lanthanide-binding aptamer 700 ± 35 uM; cacodylate 10 ± 0.5 mM; sodium chloride 150 ± 7.5 mM; thulium chloride 700 ± 35 uM

sample_6: Lanthanide-binding aptamer 700 ± 35 uM; cacodylate 10 ± 0.5 mM; sodium chloride 150 ± 7.5 mM; Lutetium chloride 700 ± 35 uM

sample_conditions_1: ionic strength: 0.16 M; pH: 6.2; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 0.16 M; pH: 6.2; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D NOESYsample_1isotropicnot available
2D 1H-13C HSQCsample_1isotropicnot available
2D 1H-1H TOCSYsample_1isotropicnot available
2D 1H-31P COSYsample_1isotropicnot available
2D 1H-1H NOESYsample_2isotropicnot available
2D 1H-13C HSQCsample_2isotropicnot available
2D 1H-1H TOCSYsample_2isotropicnot available
2D 1H-31P COSYsample_2isotropicnot available
2D NOESYsample_3isotropicnot available
2D 1H-13C HSQCsample_3isotropicnot available
2D 1H-1H TOCSYsample_3isotropicnot available
2D 1H-31P COSYsample_3isotropicnot available
2D NOESYsample_4isotropicnot available
2D 1H-13C HSQCsample_4isotropicnot available
2D 1H-1H TOCSYsample_4isotropicnot available
2D 1H-31P COSYsample_4isotropicnot available
2D NOESYsample_5isotropicnot available
2D 1H-13C HSQCsample_5isotropicnot available
2D 1H-1H TOCSYsample_5isotropicnot available
2D 1H-31P COSYsample_5isotropicnot available
2D NOESYsample_6isotropicnot available
2D 1H-1H TOCSYsample_6isotropicnot available

Software:

Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement, structure calculation

NMRFAM-SPARKY, NMRFAM - chemical shift assignment, peak picking

NMR spectrometers:

  • Bruker AVANCE III 700 MHz