BMRB Entry 34676

Title:
Solution structure of an intramolecular RNA G-quadruplex formed by the 6A8A17U mutant from a 22mer guanine-rich sequence within the 5'UTR of BCL-2 proto-oncogene
Deposition date:
2021-11-08
Original release date:
2022-11-08
Authors:
Wang, Z.; Jurt, S.; Dominguez-Martin, A.; Johannsen, S.; Sigel, R.
Citation:

Citation: Wang, Z.; Jurt, S.; Dominguez-Martin, A.; Johannsen, S.; Sigel, R.. "Solution structure of an intramolecular RNA G-quadruplex formed by the 6A8A17U mutant from a 22mer guanine-rich sequence within the 5'UTR of BCL-2 proto-oncogene "  .

Assembly members:

Assembly members:
entity_1, polymer, 22 residues, 7225.339 Da.

Natural source:

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
entity_1: GGGCCAUAGGGUGGGAUCUG GG

Data sets:
Data typeCount
13C chemical shifts182
15N chemical shifts12
1H chemical shifts184

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1unit_11

Entities:

Entity 1, unit_1 22 residues - 7225.339 Da.

1   GGGCCAUAGG
2   GUGGGAUCUG
3   GG

Samples:

sample_1: BCL-2 6A8A17U 1.3 mM

sample_2: BCL-2 6A8A17U 1.3 mM

sample_3: BCL-2 6A8A17U, [G 15N-labeled], 0.5 mM

sample_4: BCL-2 6A8A17U, [A 13C, 15N-labeled], 0.3 mM

sample_5: BCL-2 6A8A17U, [C 13C, 15N-labeled], 0.3 mM

sample_6: BCL-2 6A8A17U, [G 13C-labeled], 0.5 mM

sample_7: BCL-2 6A8A17U, [U 13C, 15N-labeled], 0.3 mM

sample_conditions_1: ionic strength: 2 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 2 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K

sample_conditions_3: ionic strength: 2 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K

sample_conditions_4: ionic strength: 2 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K

sample_conditions_5: ionic strength: 2 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K

sample_conditions_6: ionic strength: 2 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K

sample_conditions_7: ionic strength: 2 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_2
2D 1H-1H TOCSYsample_2isotropicsample_conditions_2
2D 1H-13C HSQCsample_2isotropicsample_conditions_2
JR-HMBCsample_1isotropicsample_conditions_1
H8N2 HNN-COSYsample_3isotropicsample_conditions_3
H1N2 HNN-COSYsample_3isotropicsample_conditions_3
H1pC6/8 HMBCsample_2isotropicsample_conditions_2
constant-time 1H-13C HSQCsample_4isotropicsample_conditions_4
constant-time 1H-13C HSQCsample_5isotropicsample_conditions_5
constant-time 1H-13C HSQCsample_6isotropicsample_conditions_6
constant-time 1H-13C HSQCsample_7isotropicsample_conditions_7

Software:

TopSpin v4.0.6, Bruker Biospin - collection

NMRFAM-SPARKY v1.414, Lee W, Tonelli M, Markley JL - chemical shift assignment, peak picking

X-PLOR NIH v3.0, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation

NMR spectrometers:

  • Bruker AVANCE 600 MHz
  • Bruker AVANCE 700 MHz