Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34670
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Marquevielle, J.; Amrane, S.. "NMR Structure of the U3 RNA G-quadruplex" .
Assembly members:
entity_1, polymer, 23 residues, 7585.560 Da.
entity_K, non-polymer, 39.098 Da.
Natural source: Common Name: HIV-1 06TG.HT008 Taxonomy ID: 587638 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV-1
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: CAGGGAGGUGUGGCCUGGGC
GGG
Data type | Count |
13C chemical shifts | 134 |
15N chemical shifts | 12 |
1H chemical shifts | 177 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
2 | unit_2 | 2 |
3 | unit_3 | 2 |
Entity 1, unit_1 23 residues - 7585.560 Da.
1 | C | A | G | G | G | A | G | G | U | G | ||||
2 | U | G | G | C | C | U | G | G | G | C | ||||
3 | G | G | G |
Entity 2, unit_2 - K - 39.098 Da.
1 | K |
sample_1: rHIVpro3, 1H, 1.5 mM
sample_conditions_1: ionic strength: 35 mM; pH: 6.9; pressure: 1 atm; temperature: 310 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-13C HMBC | sample_1 | isotropic | sample_conditions_1 |
TopSpin, Bruker Biospin - data analysis
Sparky, Goddard - chemical shift assignment
ARIA, Linge, O'Donoghue and Nilges - structure calculation
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement