Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34631
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Marquevielle, J.; De Rache, A.; Vialet, B.; Morvan, E.; Mergny, J.; Amrane, S.. "G-quadruplex structure of the C. elegans telomeric repeat: a two tetrads basket type conformation stabilized by a non-canonical C-T base-pair
" Nucleic Acids Res. 50, 7134-7146 (2022).
PubMed: 35736226
Assembly members:
entity_1, polymer, 20 residues, 6221.012 Da.
entity_K, non-polymer, 39.098 Da.
Natural source: Common Name: C. elegans Taxonomy ID: 6239 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Caenorhabditis elegans
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGCTTAGGCTTAGGCTTAGG
| Data type | Count |
| 13C chemical shifts | 69 |
| 1H chemical shifts | 184 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
| 2 | unit_2 | 2 |
Entity 1, unit_1 20 residues - 6221.012 Da.
| 1 | DG | DG | DC | DT | DT | DA | DG | DG | DC | DT | |
| 2 | DT | DA | DG | DG | DC | DT | DT | DA | DG | DG |
Entity 2, unit_2 - K - 39.098 Da.
| 1 | K |
sample_1: Asc20 2.4 mM; KCl 70 mM; KPi 20 mM
sample_conditions_1: ionic strength: 90 mM; pH: 6.9; pressure: 1 atm; temperature: 288 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | anisotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | anisotropic | sample_conditions_1 |
| 2D 1H-13C HMBC | sample_1 | anisotropic | sample_conditions_1 |
TopSpin, Bruker Biospin - processing
Sparky, Goddard - chemical shift assignment
ARIA, Linge, O'Donoghue and Nilges - structure calculation
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement