Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34529
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Lenarcic Zivkovic, M.; Rozman, J.; Plavec, J.. "Structure of a DNA G-Quadruplex Related to Osteoporosis with a G-A Bulge Forming a Pseudo-loop
" Molecules 25, 4867-4867 (2020).
PubMed: 33096904
Assembly members:
entity_1, polymer, 20 residues, 6401.113 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TGGGAGGGAGCGGGAGTGGG
| Data type | Count |
| 1H chemical shifts | 185 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
Entity 1, unit_1 20 residues - 6401.113 Da.
| 1 | DT | DG | DG | DG | DA | DG | DG | DG | DA | DG | |
| 2 | DC | DG | DG | DG | DA | DG | DT | DG | DG | DG |
sample_1: DNA (5'-D(*TP*GP*GP*GP*AP*GP*GP*GP*AP*GP*CP*GP*GP*GP*AP*GP*TP*GP*GP*G)-3') 0.6 mM
sample_2: DNA (5'-D(*TP*GP*GP*GP*AP*GP*GP*GP*AP*GP*CP*GP*GP*GP*AP*GP*TP*GP*GP*G)-3') 0.6 mM
sample_conditions_1: ionic strength: 70 mM; pH: 7; pressure: 1 atm; temperature: 298 K
sample_conditions_2: ionic strength: 70 mM; pH: 7; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | anisotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | anisotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | anisotropic | sample_conditions_2 |
| 2D 1H-1H NOESY | sample_2 | anisotropic | sample_conditions_2 |
| 2D 1H-1H TOCSY | sample_2 | anisotropic | sample_conditions_2 |
| 2D DQF-COSY | sample_2 | anisotropic | sample_conditions_2 |
Sparky, Goddard - chemical shift assignment
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement, structure calculation
VNMR, Varian - processing