Click here to enlarge.
PDB ID: 6xxa
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34484
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Binas, O.; Tants, J.; Peter, S.; Janowski, R.; Davydova, E.; Braun, J.; Niessing, D.; Schwalbe, H.; Weigand, J.; Schlundt, A.. "Structural basis for the recognition of transiently structured AU-rich elements by Roquin" Nucleic Acids Res. 48, 7385-7403 (2020).
PubMed: 32491174
Assembly members:
entity_1, polymer, 21 residues, 6690.004 Da.
Natural source: Common Name: Thermosinus carboxydivorans Nor1 Taxonomy ID: 401526 Superkingdom: Bacteria Kingdom: not available Genus/species: Thermosinus carboxydivorans
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGUGCCUAAUAUUUAGGCAC
C
Data type | Count |
13C chemical shifts | 94 |
1H chemical shifts | 159 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
Entity 1, unit_1 21 residues - 6690.004 Da.
1 | G | G | U | G | C | C | U | A | A | U | ||||
2 | A | U | U | U | A | G | G | C | A | C | ||||
3 | C |