Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34431
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Marquevielle, J.; Robert, C.; Lagrabette, O.; Wahid, M.; Bourdoncle, A.; Xodo, L.; Mergny, J.; Salgado, G.. "Structure of two G-quadruplexes in equilibrium in the KRAS promoter
" Nucleic Acids Res. 48, 9336-9345 (2020).
PubMed: 32432667
Assembly members:
entity_1, polymer, 32 residues, 10246.573 Da.
entity_K, non-polymer, 39.098 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: AGGGCGGTTTGGGAAGAGGG
AAGAGGGGGAGG
| Data type | Count |
| 13C chemical shifts | 167 |
| 15N chemical shifts | 13 |
| 1H chemical shifts | 289 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
| 2 | entity_2, 1 | 2 |
| 3 | entity_2, 2 | 2 |
Entity 1, entity_1 32 residues - 10246.573 Da.
| 1 | DA | DG | DG | DG | DC | DG | DG | DT | DT | DT | ||||
| 2 | DG | DG | DG | DA | DA | DG | DA | DG | DG | DG | ||||
| 3 | DA | DA | DG | DA | DG | DG | DG | DG | DG | DA | ||||
| 4 | DG | DG |
Entity 2, entity_2, 1 - K - 39.098 Da.
| 1 | K |
sample_1: KRAS32R G9T 2 mM; KCl 50 mM; KPi 10 mM
sample_2: KRAS32R G9T, [U-99% 13C; U-99% 15N], 0.5 mM; KCl 50 mM; KPi 10 mM
sample_conditions_1: ionic strength: 60 mM; pH: 6.66; pressure: 1 atm; temperature: 310 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | anisotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_2 | anisotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aromatic | sample_2 | anisotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aliphatic | sample_2 | anisotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | anisotropic | sample_conditions_1 |
Amber v12, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement
ARIA, Linge, O'Donoghue and Nilges - structure calculation
Sparky, Goddard - chemical shift assignment
TopSpin, Bruker Biospin - processing