Click here to enlarge.
PDB ID: 6h1k
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34302
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Butovskaya, E.; Heddi, B.; Bakalar, B.; Richter, S.; Phan, A.. "Major G-Quadruplex Form of HIV-1 LTR Reveals a (3 + 1) Folding Topology Containing a Stem-Loop" J. Am. Chem. Soc. 140, 13654-13662 (2018).
PubMed: 30299955
Assembly members:
entity_1, polymer, 28 residues, 8865.647 Da.
Natural source: Common Name: HIV-1 Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV-1
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGAGGCGTGGCCTGGGCGG
GACTGGGG
Data type | Count |
1H chemical shifts | 229 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entity 1, entity_1 28 residues - 8865.647 Da.
1 | DG | DG | DG | DA | DG | DG | DC | DG | DT | DG | ||||
2 | DG | DC | DC | DT | DG | DG | DG | DC | DG | DG | ||||
3 | DG | DA | DC | DT | DG | DG | DG | DG |