Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full, LACS
BMRB Entry DOI: doi:10.13018/BMR34259
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Loughlin, F.; Lukavsky, P.; Kazeeva, T.; Reber, S.; Hock, E.; Colombo, M.; Von Schroetter, C.; Pauli, P.; Clery, A.; Muhlemann, O.; Polymenidou, M.; Ruepp, M.; Allain, F.. "The Solution Structure of FUS Bound to RNA Reveals a Bipartite Mode of RNA Recognition with Both Sequence and Shape Specificity.
" Mol. Cell 73, 490-504 (2019).
PubMed: 30581145
Assembly members:
entity_1, polymer, 102 residues, 11289.521 Da.
entity_2, polymer, 23 residues, 7286.336 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: recombinant technology Host organism: Escherichia coli
Entity Sequences (FASTA):
entity_1: GSHMDNSDNNTIFVQGLGEN
VTIESVADYFKQIGIIKTNK
KTGQPMINLYTDRETGKLKG
EATVSFDDPPSAKAAIDWFD
GKEFSGNPIKVSFATRRADF
NR
entity_2: GGCAGAUUACAAUUCUAUUU
GCC
| Data type | Count |
| 13C chemical shifts | 479 |
| 15N chemical shifts | 120 |
| 1H chemical shifts | 901 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
| 2 | entity_2 | 2 |
Entity 1, entity_1 102 residues - 11289.521 Da.
| 1 | GLY | SER | HIS | MET | ASP | ASN | SER | ASP | ASN | ASN | ||||
| 2 | THR | ILE | PHE | VAL | GLN | GLY | LEU | GLY | GLU | ASN | ||||
| 3 | VAL | THR | ILE | GLU | SER | VAL | ALA | ASP | TYR | PHE | ||||
| 4 | LYS | GLN | ILE | GLY | ILE | ILE | LYS | THR | ASN | LYS | ||||
| 5 | LYS | THR | GLY | GLN | PRO | MET | ILE | ASN | LEU | TYR | ||||
| 6 | THR | ASP | ARG | GLU | THR | GLY | LYS | LEU | LYS | GLY | ||||
| 7 | GLU | ALA | THR | VAL | SER | PHE | ASP | ASP | PRO | PRO | ||||
| 8 | SER | ALA | LYS | ALA | ALA | ILE | ASP | TRP | PHE | ASP | ||||
| 9 | GLY | LYS | GLU | PHE | SER | GLY | ASN | PRO | ILE | LYS | ||||
| 10 | VAL | SER | PHE | ALA | THR | ARG | ARG | ALA | ASP | PHE | ||||
| 11 | ASN | ARG |
Entity 2, entity_2 23 residues - 7286.336 Da.
| 1 | G | G | C | A | G | A | U | U | A | C | ||||
| 2 | A | A | U | U | C | U | A | U | U | U | ||||
| 3 | G | C | C |
sample_1: FUS-RRM, [U-99% 13C; U-99% 15N], 0.8 mM; RNA stem loop, [U-99% 15N], 0.8 mM; sodium phosphate 20 mM; beta-mercaptoethanol 1 mM
sample_2: FUS-RRM, [U-99% 13C; U-99% 15N], 0.8 mM; sodium phosphate 20 mM; beta-mercaptoethanol 1 mM; stem-loop RNA, [U-99% 15N], 0.8 mM
sample_3: FUS-RRM, [U-99% 15N], 1 mM; sodium phosphate 20 mM; beta-mercaptoethanol 1 mM; stem-loop RNA, [U-99% 13C; U-99% 15N], 0.8 mM
sample_4: FUS-RRM, [U-99% 15N], 1.0 mM; sodium phosphate 20 mM; beta-mercaptoethanol 1 mM; stem-loop RNA, [U-99% 13C; U-99% 15N], 0.8 mM
sample_5: FUS-RRM, [U-99% 15N], 1.0 mM; sodium phosphate 20 mM; beta-mercaptoethanol 1 mM; stem-loop RNA, [U-99% 15N], 1.0 mM
sample_conditions_1: ionic strength: 20 mM; pH: 6.5; pressure: 1 Pa; temperature: 303 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 3D 1H-13C NOESY aromatic | sample_1 | isotropic | sample_conditions_1 |
| 3D 1H-15N NOESY | sample_1 | isotropic | sample_conditions_1 |
| 3D 1H-13C NOESY aliphatic | sample_1 | isotropic | sample_conditions_1 |
| 3D 1H-13C NOESY aliphatic | sample_4 | isotropic | sample_conditions_1 |
| 3D 1H-13C NOESY aromatic | sample_4 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_5 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_3 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_4 | isotropic | sample_conditions_1 |
AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement
CYANA, Guntert, Mumenthaler and Wuthrich - structure calculation
SPARKY, Goddard - data analysis
CANDID, Herrmann, Guntert and Wuthrich - peak picking
TOPSPIN, Bruker Biospin - collection, processing
Download HSQC peak lists in one of the following formats:
CSV: Backbone
or all simulated peaks
SPARKY: Backbone
or all simulated peaks