Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34228
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Haase, L.; Dickerhoff, J.; Weisz, K.. "DNA-RNA Hybrid Quadruplexes Reveal Interactions that Favor RNA Parallel Topologies
" Chemistry 24, 15365-15371 (2018).
PubMed: 30084512
Assembly members:
entity_1, polymer, 22 residues, 7004.491 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGATGGGACACAGGGGACG
GG
| Data type | Count |
| 13C chemical shifts | 21 |
| 1H chemical shifts | 142 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entity 1, entity_1 22 residues - 7004.491 Da.
| 1 | G | DG | DG | DA | DT | DG | DG | DG | DA | DC | ||||
| 2 | DA | DC | DA | DG | DG | DG | DG | DA | DC | G | ||||
| 3 | DG | DG |
sample_1: potassium phosphate 10 mM; entity_1 0.48 mM
sample_2: potassium phosphate 10 mM; entity_1 0.48 mM
sample_conditions_1: ionic strength: 10 mM; pH: 7; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY mixing time 500 ms | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY mixing time 300 ms | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY mixing time 150 ms | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY mixing time 80 ms | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aromatic | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY mixing time 300 ms | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aromatic | sample_2 | isotropic | sample_conditions_1 |
| 2D DQF-COSY | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_2 | isotropic | sample_conditions_1 |
TOPSPIN v3.5, Bruker Biospin - processing
Analysis v2.4, CCPN - chemical shift assignment, peak picking
X-PLOR NIH v2.46, Schwieters, Kuszewski, Tjandra and Clore - refinement
AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - structure calculation