Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34145
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Marusic, Maja; Plavec, Janez. "Towards Understanding of Polymorphism of the G-rich Region of Human Papillomavirus Type 52
" Molecules 24, E1294-E1294 (2019).
PubMed: 30987050
Assembly members:
entity_1, polymer, 23 residues, 7276.684 Da.
Natural source: Common Name: Human papillomavirus type 52 Taxonomy ID: 10618 Superkingdom: Viruses Kingdom: not available Genus/species: Alphapapillomavirus Alphapapillomavirus 9
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGTAGGGCAGGGGACACAG
GGT
| Data type | Count |
| 13C chemical shifts | 27 |
| 1H chemical shifts | 221 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entity 1, entity_1 23 residues - 7276.684 Da.
| 1 | DG | DG | DG | DT | DA | DG | DG | DG | DC | DA | ||||
| 2 | DG | DG | DG | DG | DA | DC | DA | DC | DA | DG | ||||
| 3 | DG | DG | DT |
sample_1: entity_1 1.2 ± 0.1 mM; potassium phosphate 10 ± 0.5 mM; potassium chloride 40 ± 0.5 mM
sample_2: entity_1 1.2 ± 0.1 mM; potassium phosphate 10 ± 0.5 mM; potassium chloride 40 ± 0.5 mM
sample_3: entity_1, 15N site-specifically labelled at 5%, 0.9 ± 0.1 mM; potassium phosphate 10 ± 0.5 mM; potassium chloride 40 ± 0.5 mM
sample_conditions_1: ionic strength: 50 mM; pH: 6.8; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_2 | isotropic | sample_conditions_1 |
| 2D DQF-COSY | sample_2 | isotropic | sample_conditions_1 |
| 2D HP COSY | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aromatic | sample_3 | isotropic | sample_conditions_1 |
vnmrj v3., Agilent - collection
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
SPARKY v3.115, Goddard - chemical shift assignment, data analysis, peak picking
AMBER v14, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement, structure calculation