Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34135
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Trajkovski, Marko; Endoh, Tamaki; Tateishi-Karimata, Hisae; Ohyama, Tatsuya; Tanaka, Shigenori; Plavec, Janez; Sugimoto, Naoki. "Pursuing origins of (poly)ethylene glycol-induced G-quadruplex structural modulations
" Nucleic Acids Res. 46, 4301-4315 (2018).
PubMed: 29648656
Assembly members:
entity_1, polymer, 20 residues, 6321.064 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TAGGGACGGGCGGGCAGGGT
| Data type | Count |
| 1H chemical shifts | 182 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entity 1, entity_1 20 residues - 6321.064 Da.
| 1 | DT | DA | DG | DG | DG | DA | DC | DG | DG | DG | |
| 2 | DC | DG | DG | DG | DC | DA | DG | DG | DG | DT |
sample_1: M2 0.2 mM; potassium chloride 100 mM; potassium phosphate 20 mM
sample_conditions_1: ionic strength: 120 mM; pH: 7.0; pressure: 1 bar; temperature: 298 K
sample_conditions_2: ionic strength: 120 mM; pH: 7.0; pressure: 1 bar; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | anisotropic | sample_conditions_1 |
| 2D DQF-COSY | sample_1 | anisotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | anisotropic | sample_conditions_2 |
| 2D 1H-1H TOCSY | sample_1 | anisotropic | sample_conditions_1 |
AMBER v14, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - structure calculation
VNMRJ, Varian - collection
SPARKY, Goddard - chemical shift assignment