Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR31239
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Edwards, Jerome; Kachale, Ambar; McCleery, Spencer; Law, Gabrielle; Patel, Vivek; D'Souza, Victoria; Pham, Vincent. "The Ebolavirus transcriptional regulatory signal equilibrates between two structural conformations to affect VP30 binding
" J. Mol. Biol. 437, 169464-169464 (2025).
PubMed: 41015113
Assembly members:
entity_1, polymer, 23 residues, 7294.361 Da.
Natural source: Common Name: Ebola virus Taxonomy ID: 1570291 Superkingdom: Viruses Kingdom: not available Genus/species: Ebola virus
Experimental source: Production method: recombinant technology
Entity Sequences (FASTA):
entity_1: CUCCUUCUAAUUAUUAAAAG
GAG
| Data type | Count |
| 1H chemical shifts | 114 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
Entity 1, unit_1 23 residues - 7294.361 Da.
| 1 | C | U | C | C | U | U | C | U | A | A | ||||
| 2 | U | U | A | U | U | A | A | A | A | G | ||||
| 3 | G | A | G |
sample_1: ribonucleic acid 1 mM; Tris HCl 50 mM; NaCl 100 mM; MgCl2 1 mM
sample_2: ribonucleic acid 1 mM; Tris HCl 50 mM; NaCl 100 mM; MgCl2 1 mM
sample_conditions_1: ionic strength: 150 mM; pH: 7.5; pressure: 100000 Pa; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
NMRViewJ, NMRFx - chemical shift assignment, peak picking
CYANA, Guntert, Mumenthaler and Wuthrich - data analysis, structure calculation
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement