Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR31061
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Ma, Sicong; Kotar, Anita; Hall, Ian; Grote, Scott; Rouskin, Silvi; Keane, Sarah. "Structure of pre-miR-31 reveals an active role in Dicer-TRBP complex processing
" Proc. Natl. Acad. Sci. U. S. A. 120, e2300527120-e2300527120 (2023).
PubMed: 37725636
Assembly members:
entity_1, polymer, 71 residues, 22872.592 Da.
Natural source: Common Name: human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGAGAGGAGGCAAGAUGCUG
GCAUAGCUGUUGAACUGGGA
ACCUGCUAUGCCAACAUAUU
GCCAUCUUUCC
| Data type | Count |
| 13C chemical shifts | 54 |
| 1H chemical shifts | 329 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
Entity 1, unit_1 71 residues - 22872.592 Da.
| 1 | G | G | A | G | A | G | G | A | G | G | ||||
| 2 | C | A | A | G | A | U | G | C | U | G | ||||
| 3 | G | C | A | U | A | G | C | U | G | U | ||||
| 4 | U | G | A | A | C | U | G | G | G | A | ||||
| 5 | A | C | C | U | G | C | U | A | U | G | ||||
| 6 | C | C | A | A | C | A | U | A | U | U | ||||
| 7 | G | C | C | A | U | C | U | U | U | C | ||||
| 8 | C |
sample_1: RNA (71-MER) 0.5 mM; KPhosphate buffer 50 mM; MgCl2 1 mM
sample_2: RNA (71-MER), A2rGr-labeled, 0.45 mM; KPhosphate buffer 50 mM; MgCl2 1 mM
sample_3: RNA (71-MER), A2rGrUr-labeled, 0.45 mM; KPhosphate buffer 50 mM; MgCl2 1 mM
sample_4: RNA (71-MER), AHCH-labeled, 0.45 mM; KPhosphate buffer 50 mM; MgCl2 1 mM
sample_5: RNA (71-MER), GHU6r-labeled, 0.45 mM; KPhosphate buffer 50 mM; MgCl2 1 mM
sample_6: RNA (71-MER), 15N/13C AG-labeled, 0.48 mM; KPhosphate buffer 50 mM; MgCl2 1 mM
sample_7: RNA (71-MER), 15N AU-labeled, 0.56 mM; KPhosphate buffer 50 mM; MgCl2 1 mM
sample_8: RNA (71-MER), 15N/13C AG-labeled_2, 0.48 mM; KPhosphate buffer 50 mM; MgCl2 1 mM
sample_9: RNA (71-MER), 15N/13C AG-labeled_3, 0.40 mM; KPhosphate buffer 50 mM; MgCl2 1 mM
sample_10: RNA (71-MER), 15N/13C AG-labeled_4, 0.60 mM; KPhosphate buffer 50 mM; MgCl2 1 mM; Pf1 phage 10 mg/mL
sample_conditions_1: ionic strength: 0.0025 M; pH: 7.5 pD; pressure: 1 atm; temperature: 310 K
sample_conditions_2: ionic strength: 0.0025 M; pH: 7.5; pressure: 1 atm; temperature: 310 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_3 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_4 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_5 | isotropic | sample_conditions_1 |
| 2D 1H-13C IPAP-HSQC | sample_9 | isotropic | sample_conditions_2 |
| 2D 1H-15N BESTsellr HNN COSY | sample_6 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_7 | isotropic | sample_conditions_2 |
| 2D 1H-13C HSQC | sample_6 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C IPAP-HSQC | sample_10 | anisotropic | sample_conditions_2 |
| 2D 1H-13C HSQC | sample_8 | isotropic | sample_conditions_1 |
TopSpin, Bruker Biospin - collection
NMRFx, Johnson - processing
NMRViewJ v9.2.0-b24, Johnson - chemical shift assignment
NMRViewJ, Johnson - data analysis
CYANA, Guntert, Mumenthaler and Wuthrich - structure calculation
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, and Kollman - refinement, structure calculation