Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30942
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Samuelian, John; Gremminger, Thomas; Song, Zhenwei; Poudyal, Raghav; Li, Jun; Zhou, Yuanzhe; Staller, Seth; Carballo, Johan; Roychowdhury-Saha, Manami; Chen, Shi-Jie; Burke, Donald; Heng, Xiao; Baum, Dana. "An RNA aptamer that shifts the reduction potential of metabolic cofactors
" Nat. Chem. Biol. 18, 1263-1269 (2022).
PubMed: 36097297
Assembly members:
entity_1, polymer, 38 residues, 12234.317 Da.
entity_FMN, non-polymer, 456.344 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: synthetic construct
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGAUACACAAGAGUGAUUGA
AACUAAGUCUGUGUAUCC
| Data type | Count |
| 1H chemical shifts | 165 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
| 2 | unit_2 | 2 |
Entity 1, unit_1 38 residues - 12234.317 Da.
| 1 | G | G | A | U | A | C | A | C | A | A | ||||
| 2 | G | A | G | U | G | A | U | U | G | A | ||||
| 3 | A | A | C | U | A | A | G | U | C | U | ||||
| 4 | G | U | G | U | A | U | C | C |
Entity 2, unit_2 - C17 H21 N4 O9 P - 456.344 Da.
| 1 | FMN |
sample_1: RNA (38-MER), [U-1H], 300 uM; FMN, [U-1H], 300 uM; MgCl2 20 mM
sample_2: RNA (38-MER), [A-H, C-D, G-H, U-D], 300 uM; FMN, [U-1H], 300 uM; MgCl2 20 mM
sample_3: RNA (38-MER), [A-H, C-H, G-D, U-D], 300 uM; FMN, [U-1H], 300 uM; MgCl2 20 mM
sample_4: RNA (38-MER), [A-D, C-D, G-H, U-H], 300 uM; FMN, [U-H], 300 uM; MgCl2 20 mM
sample_5: RNA (38-MER), [A-8D, C-H, G-H, U-5,6D2], 300 uM; FMN, [U-1H], 300 uM; MgCl2 20 mM
sample_6: RNA (38-MER), [U-100% 13C; U-100% 15N], 300 uM; FMN, [U-1H], 300 uM; MgCl2 20 mM
sample_7: RNA (38-MER), [U-100% 13C; U-100% 15N], 300 uM; FMN, [dioxopyrimidine-13C4, 15N2], 300 uM; MgCl2 20 mM
sample_conditions_1: ionic strength: 20 mM; pH: 7.5; pressure: 1 atm; temperature: 308 K
sample_conditions_2: ionic strength: 20 mM; pH: 6.5; pressure: 1 atm; temperature: 283 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_3 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_4 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_5 | isotropic | sample_conditions_1 |
| 2D 1H-1H COSY | sample_1 | isotropic | sample_conditions_1 |
| HNN-COSY | sample_6 | isotropic | sample_conditions_2 |
| F1fF2f-NOESY | sample_6 | isotropic | sample_conditions_1 |
| F2f-NOESY | sample_6 | isotropic | sample_conditions_1 |
| HNN-COSY | sample_7 | isotropic | sample_conditions_2 |
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
NMRViewJ, Johnson - chemical shift assignment, peak picking
CYANA, Guntert, Mumenthaler and Wuthrich - geometry optimization, structure calculation
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, and Kollman - refinement