Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30816
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Wagner, N.; Edwards, J.; Abramovich, J.; Gupta, P.; Swaminathan, H.; Rouskin, S.; D'Souza, V.. "Stop codon readthrough in VEGF-A is regulated by complex signals
" .
Assembly members:
entity_1, polymer, 60 residues, 19268.506 Da.
Natural source: Common Name: cow Taxonomy ID: 9913 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Bos taurus
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: CUGCUCUACCUUCACCAUGC
CAAGUGGUCCCAGGCUGCAC
CCAUGGCAGAAGGAGGGCAG
| Data type | Count |
| 1H chemical shifts | 180 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
Entity 1, unit_1 60 residues - 19268.506 Da.
| 1 | C | U | G | C | U | C | U | A | C | C | |
| 2 | U | U | C | A | C | C | A | U | G | C | |
| 3 | C | A | A | G | U | G | G | U | C | C | |
| 4 | C | A | G | G | C | U | G | C | A | C | |
| 5 | C | C | A | U | G | G | C | A | G | A | |
| 6 | A | G | G | A | G | G | G | C | A | G |
sample_1: RNA (60-MER) 100 ± 0.1 uM
sample_2: RNA (60-MER) 100 ± 0.1 uM
sample_3: RNA (60-MER) 100 ± 0.1 uM
sample_4: RNA (60-MER) 100 ± 0.1 uM
sample_5: RNA (60-MER) 100 ± 0.1 uM
sample_conditions_1: ionic strength: 50 mM; pH: 5.6; pressure: 1 .; temperature: 280 K
sample_conditions_2: ionic strength: 50 mM; pH: 5.6; pressure: 1 .; temperature: 311 K
sample_conditions_3: ionic strength: 50 mM; pH: 8.0; pressure: 1 .; temperature: 311 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_5 | isotropic | sample_conditions_2 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_3 |
| 2D 1H-1H NOESY | sample_3 | isotropic | sample_conditions_3 |
| 2D 1H-1H NOESY | sample_4 | isotropic | sample_conditions_3 |
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
NMRViewJ, Johnson, Bruce - chemical shift assignment
CYANA, Guntert, Mumenthaler and Wuthrich - structure calculation
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement