Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30805
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Dickerhoff, Jonathan; Dai, Jixun; Yang, Danzhou. "Structural recognition of the MYC promoter G-quadruplex by a quinoline derivative: insights into molecular targeting of parallel G-quadruplexes
" Nucleic Acids Res. 49, 5905-5915 (2021).
PubMed: 33978746
Assembly members:
entity_1, polymer, 22 residues, 7008.510 Da.
entity_WAM, non-polymer, 335.376 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TGAGGGTGGGTAGGGTGGGT
AA
| Data type | Count |
| 1H chemical shifts | 221 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
| 2 | unit_2 | 2 |
| 3 | unit_3 | 2 |
Entity 1, unit_1 22 residues - 7008.510 Da.
| 1 | DT | DG | DA | DG | DG | DG | DT | DG | DG | DG | ||||
| 2 | DT | DA | DG | DG | DG | DT | DG | DG | DG | DT | ||||
| 3 | DA | DA |
Entity 2, unit_2 - C20 H19 N2 O3 - 335.376 Da.
| 1 | WAM |
sample_1: Myc2345_T23 0.7 mM; NSC85697 2.1 mM; potassium phosphate 10 mM
sample_conditions_1: ionic strength: 10 mM; pH: 6.5; pressure: 1 atm; temperature: 298 K
sample_conditions_2: ionic strength: 10 mM; pH: 6.5; pressure: 1 atm; temperature: 293 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D NOESY | sample_1 | isotropic | sample_conditions_2 |
Amber v16, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, and Kollman - refinement, structure calculation
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - structure calculation
CcpNmr Analysis, CCPN - chemical shift assignment, peak picking