Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30724
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Brown, Joshua; Kharytonchyk, Siarhei; Chaudry, Issac; Iyer, Aishwarya; Carter, Hannah; Becker, Ghazal; Desai, Yash; Glang, Lindsay; Choi, Seung; Singh, Karndeep; Lopresti, Michael; Orellana, Matthew; Rodriguez, Tatiana; Oboh, Ubiomo; Hijji, Jana; Ghinger, Frances Grace; Stewart, Kailan; Francis, Dillion; Edwards, Bryce; Chen, Patrick; Case, David; Telesnitsky, Alice; Summers, Michael. "Structural basis for transcriptional start site control of HIV-1 RNA fate
" Science 368, 413-417 (2020).
PubMed: 32327595
Assembly members:
entity_1, polymer, 130 residues, 41923.793 Da.
Natural source: Common Name: HIV-1 Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV-1
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: XGUCUCUCUUGUUAGACCAG
GUCGAGCCCGGGAGCUCUCU
GGCUAGCAAGGAACCCACUG
CUUAAGCCUCAAUAAAGCUU
GCCUUGAGUGCCUCAAGCAG
UGUGUGCCCAUCUCGAGAGA
GAUGGGUGCG
| Data type | Count |
| 1H chemical shifts | 613 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entity 1, entity_1 130 residues - 41923.793 Da.
| 1 | M7G | G | U | C | U | C | U | C | U | U | |
| 2 | G | U | U | A | G | A | C | C | A | G | |
| 3 | G | U | C | G | A | G | C | C | C | G | |
| 4 | G | G | A | G | C | U | C | U | C | U | |
| 5 | G | G | C | U | A | G | C | A | A | G | |
| 6 | G | A | A | C | C | C | A | C | U | G | |
| 7 | C | U | U | A | A | G | C | C | U | C | |
| 8 | A | A | U | A | A | A | G | C | U | U | |
| 9 | G | C | C | U | U | G | A | G | U | G | |
| 10 | C | C | U | C | A | A | G | C | A | G | |
| 11 | U | G | U | G | U | G | C | C | C | A | |
| 12 | U | C | U | C | G | A | G | A | G | A | |
| 13 | G | A | U | G | G | G | U | G | C | G |
sample_1: Cap1G-TPUA, 1H, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM
sample_2: Cap1G-TPUA, Gh, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM
sample_3: Cap1G-TPUA, A2rGr, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM
sample_4: Cap1G-TPUA, GhU6r, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM
sample_5: Cap1G-TPUA, U6r, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM
sample_6: Cap1G-TPUA, C6r, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM
sample_7: Cap1G-TPUA, C6rU6r, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM
sample_8: Cap1G-TPUA, AhCh, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM
sample_9: Cap1G-TPUA, U6r, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM
sample_10: Cap1G-TPUA, 1H, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM
sample_11: Cap1G-TPUA, Gh, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM
sample_12: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, 1H, 150 uM
sample_13: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, Ah, 150 uM
sample_14: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, Ch, 150 uM
sample_15: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, Uh, 150 uM
sample_16: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, A2rCr, 150 uM
sample_17: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, A2rUr, 150 uM
sample_18: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, C6rUr, 150 uM
sample_19: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, CrU6r, 150 uM
sample_20: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, AhCh, 150 uM
sample_21: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, ChGh, 150 uM
sample_22: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, GhUh, 150 uM
sample_23: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, AhUh, 150 uM
sample_24: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 M; 2G-TPUA, AhGh, 150 uM
sample_conditions_1: ionic strength: 133 mM; pH: 7.4; pressure: 1 atm; temperature: 308 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_3 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_4 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_5 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_6 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_7 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_8 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_9 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_10 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_11 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_12 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_13 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_14 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_15 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_16 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_17 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_18 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_19 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_20 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_21 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_22 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_23 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_24 | isotropic | sample_conditions_1 |
NMRFx, Johnson, One Moon Scientific - processing
NMRView, Johnson, One Moon Scientific - chemical shift assignment, data analysis, peak picking
CYANA, Guntert, Mumenthaler and Wuthrich - geometry optimization, refinement, structure calculation
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, and Kollman - refinement, structure calculation