BMRB Entry 30724

Click here to enlarge.

PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30724
MolProbity Validation Chart

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry

Title:
Cap1G-TPUA
Deposition date:
2020-02-18
Original release date:
2020-04-27
Authors:
Summers, M.; Brown, J.
Citation:

Citation: Brown, Joshua; Kharytonchyk, Siarhei; Chaudry, Issac; Iyer, Aishwarya; Carter, Hannah; Becker, Ghazal; Desai, Yash; Glang, Lindsay; Choi, Seung; Singh, Karndeep; Lopresti, Michael; Orellana, Matthew; Rodriguez, Tatiana; Oboh, Ubiomo; Hijji, Jana; Ghinger, Frances Grace; Stewart, Kailan; Francis, Dillion; Edwards, Bryce; Chen, Patrick; Case, David; Telesnitsky, Alice; Summers, Michael. "Structural basis for transcriptional start site control of HIV-1 RNA fate"  Science 368, 413-417 (2020).
PubMed: 32327595

Assembly members:

Assembly members:
entity_1, polymer, 130 residues, 41923.793 Da.

Natural source:

Natural source:   Common Name: HIV-1   Taxonomy ID: 11676   Superkingdom: Viruses   Kingdom: not available   Genus/species: Lentivirus HIV-1

Experimental source:

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
entity_1: XGUCUCUCUUGUUAGACCAG GUCGAGCCCGGGAGCUCUCU GGCUAGCAAGGAACCCACUG CUUAAGCCUCAAUAAAGCUU GCCUUGAGUGCCUCAAGCAG UGUGUGCCCAUCUCGAGAGA GAUGGGUGCG

Data sets:
Data typeCount
1H chemical shifts613

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 130 residues - 41923.793 Da.

1   M7GGUCUCUCUU
2   GUUAGACCAG
3   GUCGAGCCCG
4   GGAGCUCUCU
5   GGCUAGCAAG
6   GAACCCACUG
7   CUUAAGCCUC
8   AAUAAAGCUU
9   GCCUUGAGUG
10   CCUCAAGCAG
11   UGUGUGCCCA
12   UCUCGAGAGA
13   GAUGGGUGCG

Samples:

sample_1: Cap1G-TPUA, 1H, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM

sample_2: Cap1G-TPUA, Gh, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM

sample_3: Cap1G-TPUA, A2rGr, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM

sample_4: Cap1G-TPUA, GhU6r, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM

sample_5: Cap1G-TPUA, U6r, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM

sample_6: Cap1G-TPUA, C6r, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM

sample_7: Cap1G-TPUA, C6rU6r, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM

sample_8: Cap1G-TPUA, AhCh, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM

sample_9: Cap1G-TPUA, U6r, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM

sample_10: Cap1G-TPUA, 1H, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM

sample_11: Cap1G-TPUA, Gh, 150 uM; KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM

sample_12: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, 1H, 150 uM

sample_13: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, Ah, 150 uM

sample_14: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, Ch, 150 uM

sample_15: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, Uh, 150 uM

sample_16: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, A2rCr, 150 uM

sample_17: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, A2rUr, 150 uM

sample_18: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, C6rUr, 150 uM

sample_19: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, CrU6r, 150 uM

sample_20: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, AhCh, 150 uM

sample_21: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, ChGh, 150 uM

sample_22: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, GhUh, 150 uM

sample_23: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 mM; 2G-TPUA, AhUh, 150 uM

sample_24: KH2PO4, Deuterated, 10 mM; MgCl2 1 mM; KCl 122 M; 2G-TPUA, AhGh, 150 uM

sample_conditions_1: ionic strength: 133 mM; pH: 7.4; pressure: 1 atm; temperature: 308 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D 1H-1H NOESYsample_3isotropicsample_conditions_1
2D 1H-1H NOESYsample_4isotropicsample_conditions_1
2D 1H-1H NOESYsample_5isotropicsample_conditions_1
2D 1H-1H NOESYsample_6isotropicsample_conditions_1
2D 1H-1H NOESYsample_7isotropicsample_conditions_1
2D 1H-1H NOESYsample_8isotropicsample_conditions_1
2D 1H-1H NOESYsample_9isotropicsample_conditions_1
2D 1H-1H NOESYsample_10isotropicsample_conditions_1
2D 1H-1H NOESYsample_11isotropicsample_conditions_1
2D 1H-1H NOESYsample_12isotropicsample_conditions_1
2D 1H-1H NOESYsample_13isotropicsample_conditions_1
2D 1H-1H NOESYsample_14isotropicsample_conditions_1
2D 1H-1H NOESYsample_15isotropicsample_conditions_1
2D 1H-1H NOESYsample_16isotropicsample_conditions_1
2D 1H-1H NOESYsample_17isotropicsample_conditions_1
2D 1H-1H NOESYsample_18isotropicsample_conditions_1
2D 1H-1H NOESYsample_19isotropicsample_conditions_1
2D 1H-1H NOESYsample_20isotropicsample_conditions_1
2D 1H-1H NOESYsample_21isotropicsample_conditions_1
2D 1H-1H NOESYsample_22isotropicsample_conditions_1
2D 1H-1H NOESYsample_23isotropicsample_conditions_1
2D 1H-1H NOESYsample_24isotropicsample_conditions_1

Software:

NMRFx, Johnson, One Moon Scientific - processing

NMRView, Johnson, One Moon Scientific - chemical shift assignment, data analysis, peak picking

CYANA, Guntert, Mumenthaler and Wuthrich - geometry optimization, refinement, structure calculation

Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, and Kollman - refinement, structure calculation

NMR spectrometers:

  • Bruker AVANCE 800 MHz