BMRB Entry 30622

Name: Solution Structure of lncRNA (LINK-A) 20-nt Hexaloop Hairpin
Published: 2020-06-26

Click here to enlarge.

PDB ID: 6pk9
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30622
MolProbity Validation Chart

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry

Nicholas Rego and David Koes
3Dmol.js: molecular visualization with WebGL
Bioinformatics (2015) 31 (8): 1322-1324 doi:10.1093/bioinformatics/btu829

Select model:

I am color blind

Download raw data. Direct link to this display. Help

Title:

Solution Structure of lncRNA (LINK-A) 20-nt Hexaloop Hairpin

Deposition date:

2019-06-28

Original release date:

2020-06-26

Authors:

Amado, A.; Walker, M.; Varani, G.

Citation:

Citation: Amado, A.; Walker, M.; Varani, G.. "Structure of the lncRNA LINK-A Hexaloop Hairpin in PI(3,4,5)P3 Interaction" .

Assembly members:

Assembly members:
entity_1, polymer, 20 residues, 6414.854 Da.

Natural source:

Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens

Experimental source:

Experimental source: Production method: chemical synthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
entity_1: GGAGGGUAGACUCGCUCUCC

Data sets:

assigned_chemical_shifts
- assigned_chemical_shifts_1

Data type	Count
13C chemical shifts	109
15N chemical shifts	8
1H chemical shifts	163

Additional metadata:

Assembly
Samples and Experiments
Software
Spectrometers
Hide all

Assembly:

Entity Assembly ID	Entity Name	Entity ID
1	entity_1	1

Entities:

Entity 1, entity_1 20 residues - 6414.854 Da.

1		G	G	A	G	G	G	U	A	G	A
2		C	U	C	G	C	U	C	U	C	C

Samples:

sample_1: RNA 0.9 mM; Sodium Phosphate 20 mM; EDTA 0.01 mM

sample_2: RNA 0.6 mM; Sodium Phosphate 20 mM; EDTA 0.01 mM

sample_3: RNA, [U-13C; U-15N], 0.5 mM; Sodium Phosphate 20 mM; EDTA 0.01 mM

sample_4: RNA, [U-13C; U-15N], 0.5 mM; Sodium Phosphate 20 mM; EDTA 0.01 mM

sample_conditions_1: pH: 6.0; pressure: 1 atm; temperature: 278 K

sample_conditions_2: pH: 6.0; pressure: 1 atm; temperature: 298 K

sample_conditions_3: pH: 6.0; pressure: 1 atm; temperature: 298 K

Experiments:

Name	Sample	Sample state	Sample conditions
2D 1H-1H NOESY	sample_1	isotropic	sample_conditions_1
2D 1H-1H TOCSY	sample_2	isotropic	sample_conditions_2
2D 1H-1H NOESY	sample_2	isotropic	sample_conditions_2
2D 1H-1H NOESY	sample_2	isotropic	sample_conditions_3
2D 1H-15N HSQC	sample_3	isotropic	sample_conditions_1
2D 1H-13C HSQC	sample_4	isotropic	sample_conditions_2

Software:

TopSpin, Bruker Biospin - processing

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation

Sparky, Goddard - chemical shift assignment, peak picking

NMR spectrometers:

Bruker AVANCE III 800 MHz
Bruker AVANCE III 600 MHz