Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30512
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Pham, V.; Salguero, C.; Khan, S.; Meagher, J.; Brown, W.; Humbert, N.; de Rocquigny, H.; Smith, J.; D'Souza, V.. "HIV-1 Tat interactions with cellular 7SK and viral TAR RNAs identifies dual structural mimicry
" Nat. Commun. 9, 4266-4266 (2018).
PubMed: 30323330
Assembly members:
entity_1, polymer, 57 residues, 18358.910 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGAUCUGUCACCCCAUUGA
UCGCCGAGAGGCUGAUCUGG
XUGGXUAGGCGGGUCCC
| Data type | Count |
| 13C chemical shifts | 49 |
| 15N chemical shifts | 27 |
| 1H chemical shifts | 207 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entity 1, entity_1 57 residues - 18358.910 Da.
| 1 | G | G | G | A | U | C | U | G | U | C | ||||
| 2 | A | C | C | C | C | A | U | U | G | A | ||||
| 3 | U | C | G | C | C | G | A | G | A | G | ||||
| 4 | G | C | U | G | A | U | C | U | G | G | ||||
| 5 | RY | U | G | G | RY | U | A | G | G | C | ||||
| 6 | G | G | G | U | C | C | C |
sample_1: 7SK RNA 0.5 ± 0.1 mM; NaCl 10 mM; NaCl 70 mM; EDTA 0.1 mM
sample_2: 7SK RNA, [U-13C; U-15N], 0.5 ± 0.1 mM; NaCl 10 mM; NaCl 70 mM; EDTA 0.1 mM
sample_3: 7SK RNA, [U-13C; U-15N], 0.5 ± 0.1 mM; NaCl 10 mM; NaCl 70 mM; EDTA 0.1 mM
sample_4: 7SK RNA 0.5 ± 0.1 mM; NaCl 10 mM; NaCl 70 mM; EDTA 0.1 mM
sample_conditions_1: ionic strength: 80 mM; pH: 5.4; pressure: 100000 Pa; temperature: 283 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_3 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_4 | isotropic | sample_conditions_1 |
TOPSPIN, Bruker Biospin - collection
NMRView, Johnson, One Moon Scientific - chemical shift assignment, peak picking
CYANA, Guntert, Mumenthaler and Wuthrich - data analysis, processing, structure calculation
AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, and Kollman - refinement