Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30045
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Dvorkin, Scarlett; Karsisiotis, Andreas; Webba da Silva, Mateus. "Encoding canonical DNA quadruplex structure.
" Sci Adv 4, eaat3007-eaat3007 (2018).
PubMed: 30182059
Assembly members:
DNA (5'-D(*GP*GP*GP*TP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*AP*GP*GP*G)-3'), polymer, 20 residues, 6348.070 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA (5'-D(*GP*GP*GP*TP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*AP*GP*GP*G)-3'): GGGTTTGGGTTTTGGGAGGG
| Data type | Count |
| 1H chemical shifts | 210 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entity 1, entity_1 20 residues - 6348.070 Da.
| 1 | DG | DG | DG | DT | DT | DT | DG | DG | DG | DT | |
| 2 | DT | DT | DT | DG | DG | DG | DA | DG | DG | DG |
sample_1: DNA, none, 1 ± 1.0 mM; H2O 93%; D2O 7%
sample_2: DNA, none, 1 ± 1 mM; D2O 100%
sample_conditions_1: ionic strength: 20 mM; pH: 6.8 pD; pressure: 1 atm; temperature: 293.15 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| H,H jr-NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
Felix, Accelrys Software Inc. - chemical shift assignment, refinement
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - structure calculation